You examine a cell under a light microscope that has been treated with a stain that makes ribosomes appear green. The cell has taken up the green stain. What type of cell is it

Answers

Answer 1

Answer:

The correct answer is - either prokaryotic or eukaryotic cell.

Explanation:

On the given observation one can not determine the cell type as both eukaryotic cells and prokaryotic cells carry ribosomes. This is the common cell organelle in both cell types, however, the subunits are different in prokaryotic and eukaryotic cells but by stain, it can no determine either. So, the given cell could either a prokaryotic or eukaryotic cell.


Related Questions

Which two key stellar properties determine all
the other stellar properties?

Answers

Answer:

way of seeling and product that he/ she is seeling

During a storm, heavy rain ___________ a large rock into smaller pieces and then those pieces are __________ downstream from one place to another. *

erodes / weather
deposits / eroded
weathered / eroded
discharges / deposits

Answers

Answer:

1) erodes

2)deposits

Explanation:

The quickest rate at which a population can grow is its ___________________________.

Answers

I believe it is its reproduction rate

Consider the stage of cellular respiration that is shown in the diagram What is the net ATP gain at this stage of cellular respiration?

Answers

Answer:

. The process being described in the diagram is Glycolysis; Thus the answer is 2ATP. The initial glucose 6-carbon molecule that is eventually broken down into 2 pyruvate 3-carbon molecules. Notice that 2 ATP are initially invested for a total of 4 ATP to be released

pls mark me the brainliest

How does your model support the claim that
the Northern and Southern Hemispheres
have different seasons?

Answers

Answer:

Due to presence on opposite side of the globe.

Explanation:

My model support the claim that  the Northern and Southern Hemispheres  have different seasons due to present on different location on the globe. The seasons in the Northern Hemisphere are different and opposite of those in the Southern Hemisphere. Seasons occur because Earth is tilted on its axis. This tilting causes summer in one location whereas winter in other location. The Earth's tilt causes the Southern Hemisphere to lean towards the Sun during summer season of Southern Hemisphere while on the other hand, it is winter season in the Northern Hemisphere which leans away from the Sun.

A mother is feeding her infant a cultural dish that contains honey. How do you manage this situation in a culturally sensitive way while considering the safety of her infant?

Answers

Call for assistance in the restaurant you are at..and explain the situation as calm as possible and take your baby to the clinic..

The situation in which a mother is feeding her infant a cultural dish that contains honey has to be taken with great consideration. This is because it is a matter of the safety of an infant.

What are the steps required for the safety of infants?

The steps required for the safety of infants are as follows:

Make a small diet plan for the infant.Do not leave your infant alone on the table, sofa, chair, etc. Always put your baby in a safe place when you are not able to hold him properly.Always follow systematic orders for vaccination.Ensure your child is hydrated all the time.Make possible events to prevent the entry of pathogens.

In this situation, you have to acknowledge to the mother that this practice is not safe for the health of your infant and try to introduce some of the negative aspects of this action. Also, warn her not to proceed with this action in the future because child safety is of utmost importance.

Therefore, the situation in which a mother is feeding her infant a cultural dish that contains honey has to be taken with great consideration.

To learn more about the Safety of infants, refer to the link:

https://brainly.com/question/28103752

#SPJ2

Describe how the complete oxidation of 1 mole of glucose can generate 32 ATPs. You should include i) products of anaerobic glycolysis with numbers, ii) products of Krebs cycles with numbers, and iii) process of ATP synthesis by electron transport chain via NADH/FADH and H ions

Answers

Answer:

Explanation:

1.During glycolysis,four molecules of ATP are formed,and two are expended to cause the initial phosphorylation of glucose to get the process going.This gives a net gain of two molecules of ATP

For every glucose molecule that undergoes cellular respiration, the citric acid cycle is carried out twice; this is because glycolysis (the first stage of aerobic respiration) produces two pyruvate molecules per glucose molecule. During pyruvate oxidation (the second stage of aerobic respiration), each pyruvate molecule is converted into one molecule of acetyl-CoA—the input into the citric acid cycle. Therefore, for every glucose molecule, two acetyl-CoA molecules are produced. Each of the two acetyl-CoA molecules goes once through the citric acid cycle.

The citric acid cycle begins with the fusion of acetyl-CoA and oxaloacetate to form citric acid. For each acetyl-CoA molecule, the products of the citric acid cycle are two carbon dioxide molecules, three NADH molecules, one FADH2 molecule, and one GTP/ATP molecule. Therefore, for every glucose molecule (which generates two acetyl-CoA molecules), the citric acid cycle yields four carbon dioxide molecules, six NADH molecules, two FADH2 molecules, and two GTP/ATP molecules. The citric acid cycle also regenerates oxaloacetate, the molecule that starts the cycle.

While the ATP yield of the citric acid cycle is modest, the generation of coenzymes NADH and FADH2 is critical for ATP production in the final stage of cellular respiration, oxidative phosphorylation. These coenzymes act as electron carriers and donate their electrons to the electron transport chain, ultimately driving the production of most of the ATP produced by cellular respiration.

In animals, if the fuel consumed exceeds energy expended, fats are synthesized from carbohydrates in order to store the excess energy. Acetyl-coA Carboxylase catalyzes the first dedicated step in fatty acid synthesis. This enzyme responds to a large number of cellular signals. A logical strategy for the regulation of Acetyl-coA Carboxylase might include:

Answers

Answer:

B) Activation when the concentration of AMP is low vs concentration of ATP

Explanation:

The ACC enzyme is reserved by the AMP i.e. activated protein kinase (AMPK)

at the time when the AMP concentration is high because it represent the energy is deficit in the cell while on the other hand the lower AMP versus ATP concentration represent that the surplus energy i.e. stored

So ACC enzyme could be activated

Therefore the option b is correct

A logical strategy for the regulation of Acetyl-coA Carboxylase might include the activation when the concentration of AMP is low versus the concentration of ATP.

Acetyl-CoA carboxylase (ACC) is an enzyme that catalyzes the carboxylation of acetyl-CoA in order to produce malonyl-CoA. The hydrolysis of ATP generates the energy required to drive this reaction.

This molecule (malonyl-CoA) is an intermediate substrate required for the regulation of fatty acid metabolism.

AMP-activated protein kinase (AMPK) is a fuel-sensing enzyme found in mammalian cells, which is required to phosphorylate the ACC protein.

This enzyme (AMPK) acts as a fuel gauge because it is activated by AMP and inhibited by ATP.

In conclusion, a logical strategy for the regulation of Acetyl-coA Carboxylase might include the activation when the concentration of AMP is low versus the concentration of ATP.

Learn more in:

https://brainly.com/question/13252116

Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first C): ATGCTGCGAAACTTTGGCTGA Provide the 6 DNA codons that would be read following the mutation. Are they the same as the original 6 DNA codons that would have been read

Answers

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

Only the first one (ATG) might coincide with one of the codons before mutation.

ALL of the following are applicable only
in the United States EXCEPT
A. Clean Water Act
B. Safe Drinking Water Act
C. Marine Protection, Research, and Sanctuaries Act
D. London Convention on the Prevention of Marine
Pollution

Answers

Answer:

the answer is C. Marine protection, research and sanctuaries Act.

why are earth and moon roughly the same age as the rest of the solar system ?

Answers

Answer:

Our solar system and everything in it was created at roughly the same time.

Explanation:

The Big Bang theory

The Moon is about 4.51 billion years old – significantly older than previously thought. Previous studies had suggested that it formed about 150 million years after the solar system.

Why is there no change in the moon's surface for billions of years?

Eventually, erosion can break a crater down to virtually nothing. The Moon has almost no erosion because it has no atmosphere. That means it has no wind, it has no weather, and it certainly has no plants. Almost nothing can remove marks on its surface once they are made.

How was the Earth and moon formed?

The Earth formed over 4.6 billion years ago out of a mixture of dust and gas around the young sun. It grew larger thanks to countless collisions between dust particles, asteroids, and other growing planets, including one last giant impact that threw enough rock, gas, and dust into space to form the moon.

Learn more about solar system here

https://brainly.com/question/1286910

#SPJ2

Los autosomas son aquellos cromosomas que se caracterizan por

Answers

Answer:

Los autosomas o cromosomas autosómicos han sido ordenados de acuerdo a la morfología que poseen. ... Cada par de cromosomas son homólogos, es decir, contienen genes idénticos, con la misma ubicación a lo largo de cada cromosoma (locus). Ambos codifican para las mismas características genéticas.

Un autosoma es cualquier de los cromosomas, excepto los cromosomas sexuales. Los humanos tienen 22 pares de autosomas y un par de cromosomas sexuales (el par número 23, formado en las mujeres por dos cromosomas X y, en los hombres, un cromosoma X y un cromosoma Y).

What is flight initiation distance FID

Answers

Answer:

Fight initiation distance (FID) is the distance at which an animal will start to move away from an approaching threat such as a trail user.

hope this helps<3

Which statement correctly compares mass and weight?
A.Both depend on the force of gravity pulling on an object B.The basic unit of both is the kilogram C.Both mass and weight ofan object would be less on the moon than on Earth D.Weight varies with location, but mass does not vary

Answers

Answer:

D. Weight varies with location, but mass does not vary

Explanation:

Weight can be defined as the force acting on a body or an object as a result of gravity.

Mathematically, the weight of an object is given by the formula;

[tex] Weight = mg [/tex]

Where;

m is the mass of the object.g is the acceleration due to gravity.

Mass can be defined as a measure of the amount of matter an object or a body comprises of. The standard unit of measurement of the mass of an object or a body is kilograms.

Irrespective of the location of an object or a body at a given moment in time, the mass (amount of matter that they're made up of) is constant. This ultimately implies that, whether you're in the moon, space, earth or any other place, your mass remains the same (constant).

Hence, the statement that correctly compares mass and weight is that, weight varies with location, but mass does not vary. This is simply because acceleration due to gravity changes with location i.e its value varies with the planets.

plants such as the venus flytrap produce chemical compounds that break down insects into substances that are usable by the plant

Answers

Answer:

The chemical compounds that break down the insects are most likely BIOLOGICAL CATALYSTS. Venus Flytrap is a kind of carnivorous plant.9

hope it helps

Which process is characterized by the movement of particles from an area of high concentration to an area of low concentration across the plasma membrane without the use of energy?

1) hypertonic transport
2) active transport
3) passive transport
4) dynamic equilibrium

Answers

Answer:

3) passive transport

Explanation:

Passive transport is a type of cellular transport that does not require the use of energy to move substances (i.e., ions and molecules) across biological membranes. Passive transport uses concentration gradients to move substances across cell membranes, thereby transporting them from regions of high concentration to regions of low concentration. Passive transport can be divided into 1-osmosis (i.e., movement of solvents), 2-diffusion (i.e., movement of solutes), and 3-facilitated diffusion (i.e., movement of molecules with help of protein channels or carriers), and 4-filtration (i.e., movement of water by using a pressure gradient).

Answer: moves particles from on area of low concentration to an area of high concentration

Explanation: Active transport differs from passive transport because active transport

can only move particles into the cell.

does not require energy to transport particles.

moves particles from an area of low concentration to an area of high concentration.

depends on the random movements of particles to carry them across the membrane.

EDG2023

Which of the following describes the products of mitosis?


two unique cells

one cell identical to the parent

cell death

two daughter cells that have identical DNA to the parent

Answers

Answer:

The products of mitosis are two diploid cells, whereas the products of meiosis are four haploid cells. -Mitosis and meiosis both begin with duplicated chromosomes. -In mitosis the daughter cells are genetically identical, but in meiosis the daughter cells are genetically varied.

Explanation:

Differences among individuals of the same species are known as:
Different offsprings, from the same parents.
A.Natural Selection
B.Adaptations
C.Variations
D.Fittness

Answers

Answer:

variation is the answer that is genetic variation

Is there anything we as a society can do to prevent these pandemic from occurring

Answers

The only thing you can do now is to try do the necessary pre-causion, which are;

Always wear maskAlways be sanitizedAlways wear hand glovesKeep social distancing

During Meiosis, an important event occurs where the chromosomes that you inherited from your mom exchange pieces with the chromosomes you inherited from your dad. This process is called:

a. Genetic Exchange
b. Recombination
c. Synapsis
d. Crossing Over

Answers

Answer:

Hi, there your answer is D.Crossing Over

Hope This Helps

PLZ CORRECT ME IF I AM WRONG :)

Explanation:

Select the correct statement Question 65 options: 1) GPP is the energy spent staying alive 2) GPP is the energy used in cellular respiration 3) GPP is part of NPP 4) NPP is the energy used in growth and reproduction

Answers

Answer:

1) GPP is the energy spent staying alive

Explanation:

Gross primary productivity is the energy that is spent by the organism to staying alive because energy is required by the organism for doing activities that is necessary for the survival. Gross primary productivity refers as the rate at which solar energy is captured in sugar molecules during the process of  photosynthesis. Producers such as plants use some of this energy for metabolism and cellular respiration as well as some for growth and building tissues.

an individual belonging to blood group A, one of whose parents was Type O, was married to an individual belonging to group AB. What would be the expected results of their offspring with blood type AB? What is the chance that any of their children would be typed A?

Answers

XA XB

XA XAXA XAXB

Y XAY XBY

25% chance the babies have blood type AB and a 50% chance the babies would have blood type A.

hope this helps!!!

How does water help drive the rock cycle?

A. It is abundant on Earth's surface.

B. It is an agent of weathering and erosion.

C. It helps Earth maintain a relatively constant temperature.

D. It maintains a liquid state in a relatively narrow range of temperatures

ap3x​

Answers

The correct answer is D

D)
transgenically reduced
12)
The energy required for a seedling to push up out of the ground comes from
A)
muscle tissue.
B)
photosynthesis.
C)
food stored in the seed.
D
other plants

Answers

Answer:

In the seed is the energy required for a seedling to push up out of the ground comes from food stored in the seed.

Which of the following is not a true statement of the lungs?

Answers

Answer: The right lung is shorter and wider than the left lung, and the left lung occupies a smaller volume than the right.

The lung houses structures of both the conducting and respiratory zones.

The left lung consists of three lobes.

The lungs exchange respiratory gases across a very large epithelial surface area—about 70 square meters

Explanation:

ways to overcome communication barriers.​

Answers

Answer:

Barriers to communication can be overcome by:

Explanation:

1. Checking whether it is good time and place to communicate with the person

2. Being clear and using language that the person understands

3. Communicating one thing at a time

4. Respecting a person's desire to not communicate

5. Checking that the person has understood you correctly

Answer:

Sent you this for a reference so please do the needful to me ASAP as I am now working on the same and I will be sending the same to you as soon as possible to send the documents to the client to complete the application form for the visa application procedure for visa application procedure so that we may be able to obtain the required necessary documentation information from our legal and professional fees to complete our registration and to return to us to complete the registration process

Watching your fish tank, you see many similarly sized fish species represented. You notice the members of one species spending more time near the top of the tank, while another closely related species spends more time on the bottom of the tank. This is an example of...

Answers

Answer:

The correct answer is - Resource partitioning.

Explanation:

Resource Partitioning is the method of differentiating in which there is differentiating in the resource and the source of nutrition so that there is no or less competition among the closely related species.

In this case, one of the species of the same size fishes spends more time on the surface of the tank, and the other spends on the bottom of the tank. This shows the example of Resource partitioning to avoid competition.

Name the main hormone that causes the tropic response movement of pollen tubes towards ovule. ​

Answers

Answer:

Chemotropism

Explanation:

There are too many potassium ions inside a cell. As a result, the cell
membrane expands and bursts. Which problem was the cell most likely
having?
A. The cell is unable to spontaneously generate.
B. The cell is unable to build more protein molecules.
C. The cell was unable to maintain a stable internal environment.
D. The cell is unable to produce water molecules inside the cell.

Answers

Answer:

Option C: The cell was unable to maintain a stable internal environment.

Explanation:

Which is NOT a passive transport mechanism across the membrane of a plant cell?


Which is NOT a passive transport mechanism across the membrane of a plant cell?

Facilitated diffusion
Diffusion
Osmosis
Receptor-mediated endocytosis

Answers

Answer:

the company has also announced plans

Other Questions
Im not sure of the answer. Check the items which describe a Bible story.little character descriptionshort sayingsmany events or actionsshort time frameone or two main events or actionsmany main charactersfew main characterslong time frameextensive character description The manufacturer price was $50. The customer purchased the item for $200. What percent of the original price did the customer pay? Read the excerpt from Iqbal. Suddenly I realized that I had to get back to work. My mind had wandered. Just in time I managed to recapture a thread I was about to lose. Then the sunbeams were blocked and the two swords of light stopped fighting. We all turned around to see the master standing in the doorway. His big body filled it. He was dressed for traveling, with a long coat that almost reached his feet and boots covered with red dust. In his left hand he held a sack, and his right hand held the arm of a boy in an iron grip. The boy was thin and dark and not very tall; he looked about two years older than me. Which detail from the excerpt best characterizes Hussain as a cruel man? If f(x) = x2 + 4, find f(3) Let p: x < -3 let q: x > 3 What is represented by p v q is 1/4 greater or is 5/4 grater onnie measures an object's mass in kilograms.Which of the following objects is he most likely measuring? A. An apple B. A bicycle C. A paper clip D. A pencil types of village layouts If 70 increased to 100 by what percent did it increase? The terms central location or central tendency relate to the way quantitative data tend to cluster around some middle or central value. a. Trueb. False Ben and Chris combined their love of football with a business venture. They purchased a small portable cart and began selling football memorabilia outside of the hometown stadium. Their first year went well, but the past two years have been a real struggle. Due to poor economic conditions including loss of jobs, ticket sales at the stadium are down, which has significantly hurt their sales as well. As a recent business school graduate, you explain to Ben and Chris that What is the number of possible outcomes in the sample space formed by rolling a dice and flipping 2 coins? I need all the help I can get Daniel and Joe watched a beetle and a spider on the sidewalk. The beetle crawled 1/2 of a yard and the spider crawled 1/8 of a yard. How much farther did the beetle crawl than the spider? what is human rights What will happen when consumers and businesses have greater confidence that they will be able to repay debt in the future? Quantity demanded of financial capital at any given interest rate will shift to the right. Quantity demanded of financial capital at any given interest rate will shift to the left. Quantity demanded of financial capital at any given interest rates below (but not above) the equilibrium will shift to the left. Quantity demanded of financial capital at interest rates below (but not above) the equilibrium will shift to the right. is this a reasonable estimate? Why? Translate the phrase into an algebraic expression.The sum of 6 and c Calculate the number of moles represented by 3.1110^24 molecules of NO2.i need help ASAP !