Write a slanted summary about "Each Kindness"

Theme: You can't always take back a mean act.

Remember to use this format:

Character, Setting, BME, Theme

Write A Slanted Summary About "Each Kindness"Theme: You Can't Always Take Back A Mean Act.Remember To

Answers

Answer 1

Oum I'm so sorry Honey i.d.k

ano ang sagot eh


Related Questions

Read this excerpt from The People Could Fly

There was a son named Anton. He dreamed that a girl placed a handkerchief over his face. He woke up but he saw no one. Anton told his mother what he had dreamed. His mother said, "Anton, you've dreamed of something enchanted."

A few days later Anton dreamed the dream again and it was exactly the same: A girl placed a handkerchief over his face.

"Anton," his mother said, "you dream of a girl who lives with her father in the tower of the moon."

How does the plot influence characterization in this excerpt?

The exposition introduces Anton as a fortune teller.
The exposition introduces Anton’s mother as a fanciful woman.
The rising action shows Anton facing the challenges of finding the tower.
The rising action shows Anton’s mother reacting to Anton’s travels.

Answers

Answer:

I think that it would be the exposition introduces antons mother as a fanciful woman

Explanation:

read the passage then drag to the boxes correctly complete the flowchart

Answers

Answer:

1: the flying shuttle

2:wool spun into thread

3:water frame invented

Explanation:

Last Thursday was April 1st, a.k.a. April Fools’ Day. Write about an April Fools joke that you had played on someone or that someone has played on you. Be sure to keep it clean. Write a 7 sentence paragraph.

Answers

Answer: I got a notification from an app called weverse that J-Hope from the group BTS had posted. It was a picture of his red hair!! I was so excited that he’d dyed it since new hair colors usually means that new music videos are being filmed. But it turned out, he used photos from back in 2018 when he had red hair and cut off the bottom part of the photo :(

Answer:

so that is why

Explanation:

it took a few weeks of planning

help iready i need help I've already gottten 2 wrong on brainly ples answer right

Answers

I think its 2 because it is the only one that makes sense

The event that takes place between Jason and Zane after the duel is  they find the painter, and he helps them return to the present. Thus, option C is correct.

What is Renaissance fair?

Renaissance fairs were regarded as spring festivities. An occasion to celebrate the passing of yet another long winter and the prospect of the coming renewal of the land and fresh harvests. The fundamentals of medieval existence that were honored annually between the conclusion of winter and the start of spring.

Jason and Zane are wishing they could be a true knight and jester at a Renaissance festival. They are transported back in time by a painter, and Jason is assisted in his duel victory by Zane. Following their fight, Jason and Zane discover the painter, who then assists them in getting back to the present. Option C is correct as an outcome.

Learn more about Renaissance fair here;

https://brainly.com/question/28837177

#SPJ2

In The Secret Garden, how does Mary respond when she enters the secret garden?

She is afraid that Ben Weatherstaff will be angry at her.

She is sad that the garden has been neglected for so long.

She wishes she had someone else to share the garden with.

She wants to help make the flowers grow again.

Answers

she wants to mans the flowers grow again! i love the secret garden!

In The Secret Garden, she wants to help make the flowers grow again is  the Mary respond when she enters the secret garden. Thus, option (d) is correct.

What is the theme of "The Secret Garden"?

"The Secret Garden" was the short story and the well-known in the English Literature. "The Secret Garden" was the written by Frances Hodgson Burnett. It was the published in 1911. The genres is children's literature, fiction. It was the published in English. The theme is happiness.

According to the story, "The Secret Garden" was the written by Frances Hodgson. "The Secret Garden" was the central idea was the based on the happiness. Mary  was the kind hearted girl. She was go to garden wants to help make the flowers grow again. She was a nature lover.

As a result, the significance of the "The Secret Garden" are the aforementioned. Therefore, option (d) is correct.

Learn more about on "The Secret Garden," here:

https://brainly.com/question/30463123

#SPJ6

On April 5, 1856, Booker T. Washington was born into slavery. Washington later became a teacher, founded Tuskegee University and was the first African-American to be shown on a postage stamp. Who is another African-American that you would honor with a postage stamp? Explain why in a 7 sentence response?

Answers

Another African American I would honor with a postage stamp would be Harriet Tubman. Harriet Tubman was an enslaved black woman who rescued slaves through safe houses known as the Underground Railroad. She was a prominent figure in political activism and was an American abolitionist. She made 13 missions to rescue about 70 slaves. What Harriet Tubman did was remarkable. She was also never caught and never lost any of her “passengers”. For these reasons, she deserves her own postage stamp to be forever immortalized in American history.

The Raven by Edgar Allen Poe
#3 Which phrases in the lines reflect the author’s use of alliteration? SELECT 3
Read the following lines from the poem.

Deep into that darkness peering, long I stood there wondering, fearing,
Doubting, dreaming dreams no mortal ever dared to dream before;
But the silence was unbroken, and the darkness gave no token,
And the only word there spoken was the whispered word, “Lenore!”
This I whispered, and an echo murmured back the word, “Lenore!”
Merely this and nothing more.


Which phrases in the lines reflect the author’s use of alliteration?

Select three options.


A. Deep into that darkness peering,

B. long I stood there wondering, fearing,

C. Doubting, dreaming dreams

D. But the silence was unbroken,

E. was the whispered word, “Lenore!”

Answers

Answer: A

Explanation:

How does Jonas’s view of his community change after he receives his first few memories?

Answers

Answer:

He has decided that the Sameness he grew up with is completely unacceptable. He is willing to go Elsewhere and release all his "memories" back into the community even though this will surely destroy it.

Answer:

He decided that things needed to change, so after all he could do was remember the bad, he went back to his community and released the bad memories.

Explanation:

Hope this helps, have a VERY nice day!!!

Read the claim below.
More countries should use hydroelectric energy, in which moving water generates electricity.
Select the piece of evidence that best supports this claim.

Answers

Answer:

A. is the answer

Explanatio

A I believe because it makes the most sense

Fix the one word that is used incorrectly.
How
will
Joey's
sprained
ankle
effect
his
ability
to
finish
out
the
football
season?

Answers

Answer:

effect should be affect

Explanation:

Affect means to have an impact on. Effect is for an outcome

effect is used incorrectly.
it should be affect not effect

Submit your one or two-paragraph essay that evaluates the arguments presented within the article. Address these questions in your writing: Which argument was more convincing? Which article was better supported? How did the persuasive language affect the strength of the article?

Article: the school garden debate

Answers

Answer:

where is this aritcle on?

Explanation:

Answer:

AHHH IM SO LATE BUT I DID THE PROJECT

HERES MY GRADE SO YALL BELIEVE ME

Anyways here you go (just re-word it)

The argument against school gardens was more persuasive than the other school garden argument. The argument against school gardens was more persuasive because some people see school gardens as taking time away from classroom academics. Research also does not provide any proof that spending time in a school garden can lead to higher graduation rates. For supporters argument it states that “Nearly every research study for the past 100 years has shown that for students to perform well after graduation, schools must teach to the whole child and provide whole-school experiences.” Personally, I don’t think that school gardens will affect students after they graduate. This is how against supporters was more convincible than the other opponents.

N the context of the text, what makes a family? How is Mike’s family impacted by hisgrandmother’s sickness and memory loss? Have you ever had an older family member fallill? How were you and your family affected?
hurry pls

Answers

Answer:

Answers with Explanations: 1. In the context of the text, what makes a family? The question is related to the story entitled "Everyday Use" by Alice Walker.. In the context of the text, not only living together makes a family but also having "respect" for each other.In relation to this, the experience that the family goes through also indicates what a family truly is.

Explanation:

Answer the following question using 2-3 sentences: Do you think that it is possible for an immigrant to be considered a patriotic American, even if they do not fully assimilate into American culture?

Answers

Can you be more specific and the link is not working.
It is absolutely possible for an immigrant to be patriotic for America. Many immigrants come to America for a better life. It is natural that they would have love for the country, even they do not fully take on American cultures. In fact, they don’t need Americanized cultures. Their culture is what makes up the American dream.

Hope that gives you something to work with :)

I need some advice for a story I'm writing for English class...
It was a dark quiet night, Halloween night when Celestia screamed. Celestia was a dragon human hybrid with dark blue hair and kind light blue eyes, dark blue wings, a dark blue tail, her hair was always in what looked like two buns on top of her head the little bit of hair that was too short-covering her ears with her bangs shadowing her face, she was in a witch costume that was black dark purple and dark pink with a black hat. Nikki came running her longish white and purple hair in a messy bun, she was wearing her mad scientist costume but the fake blood looked suspiciously realistic. Wannabe ran in looking like the human form of sans along with Angel a few feet behind him dressed as a fairy. Nikki stood staring trying not to cry. Nikki’s friend Emery came in wearing her police uniform on and blue blonde hair up in a ponytail along with Rihanna in her outfit that she wore at her concert the night before, the light baby blue costume made her light pink eyes stand out and her fox tail nearly invisible under a big black bow, her hair in ponytails right behind her fox ears. The two stared in horror at what seemed to have happened, one of their friends had been brutally murdered but their face was unrecognizable from the damage. Nikki stood up and took ad headcount matching names with faces until she realized who it was. “I’m going to find the person who did this and make them pay,” Nikki said in a dark evil angry voice, she was mad and near her breaking point. Nikki left the room unable to look at her friend lying there dead while everyone else looked at each other. “Kind convenient YOU found him like this Celie…” Rihanna said to Celestia glaring at her, the two never liked each other and were always fighting. “First of all, I couldn’t handle the blood. Second of all, that’s my friend! Why would I hurt him!?!?” Celestia snapped, angry she was accused of the crime. “You found him like this. That's a little suspicious don’t you think?” Rihanna said giving Celestia looks. “I hate to say this but Nikki could have been faking the blood on her costume looks a bit too realistic…” Angel said her voice trailing off, she hated to accuse Nikki but at this point, they were all suspects except for Angel. She had said before that she'd never been able to kill someone and get away with it she’d end up admitting she did it. Nikki came back in a completely different costume, her Sara Sanderson costume to be exact. “Why did you change costumes?” Angel questioned Nikki, changing costumes because there was what looked like blood on the other was suspicious. “You act like I can choose to wear only one costume, heck I’ll probably end up wearing a cosplay before we figure out who did this,” Nikki answered, it was true Nikki tended to wear up to ten outfits a day so why would today be any different? Emery glared at Nikki, she didn’t believe her story. “Seems pretty convenient she had to change costumes so soon...” She thought suspecting Nikki was hiding something. “Let’s do this Danganronpa style!” Angel shouted, she had always thought how they did the class trials on that anime and in the game was cool. Everyone got to a podium and glared at one another. “I was passing out candy to the trick-or-treaters,” Rihanna said then turning her head to Celestia who was on her left. “I was in the Bathroom,” Celestia said, nobody was going to question her now. “I was fixing my fursuit, one of the ears fell off,” Nikki said with the tail to her fursuit in hand. “I was outside sitting on the porch,” Emery said pointing at the door. “I’m too dum.b to pull something like this off you guys know this,” Angel stated honestly, she wasn’t the brightest bulb. “I was in the kitchen when I heard someone yell for help.” Wannabe said solemnly.


Who killed him?
Btw it was cosmic that was killed. For some reason, he was a pirate. He ran into many walls. Glasses and an eye patch, not gonna mix well… ALSO! His body was found in the hallway next to the stairs.

Answers

I really liked the attention to detail other than a few granitas errors it’s good

How does collaboration help you feel a sense of belonging in the classroom?

Answers

Answer:

amazing

Explanation:

Teamwork helps you feel part of a team.

HELP RN ASAPPPPPPPP !!!!!!!!!!!!!!!!!
Nature’s first green is gold,
Her hardest hue to hold.
Her early leaf’s a flower;
But only so an hour.
Then leaf subsides to leaf.
So Eden sank to grief,
So dawn goes down to day.
Nothing gold can stay

This is an example of,,,,,
a
Free verse
b
Stanza
c
Traditional
d
Sonnet

Answers

C. Or B. I hope this helps

Answer:

do you still need help

Explanation:

Part A Which structure does the author use to organize information in the text “Water Efficiency Strategies”? The author lists terms that define different kinds of water systems. The author shares examples of times that consumers tend to use the least amount of water. The author compares and contrasts three possible ways to conserve water in each paragraph. The author uses a heading for each method of conserving water. Question 2 Part B How does the section "Demand-Side Strategies for Water Suppliers" contribute to the structure and organization identified in Part A? It includes water efficiency measures that consumers and suppliers can implement. It informs the reader about programs that address each water conservation method in the text.

Answers

Answer:

Part A

The author uses a heading for each method of conserving water.

Part B

It provides examples of ways consumers can reduce their water usage.

Explanation:

K12 test

The structure the author uses to organize information in his text is that A. The author lists terms that define different kinds of water systems.

What is a structure?

This is an arrangement and organization of and relations between parts or elements of something complex.

The author used the strategy of listing the terms that define the different kinds of water system.

The section, "Demand-Side Strategies for Water Suppliers" contributed to the structure and organization of the different types of water system by B. It informs the reader about programs that address each water conservation method in the text.

Read moe about structure here:

https://brainly.com/question/14751566

How would your life be different if you did not easy access to clean, sanitary water? Explain in details how your daily routine would be impacted.

Answers

Answer:

yes it would be different

Explanation:

if we didn't have clean water, we would get sick if we drank it. if we need to wash something (food, hands, face, etc) it would end up not being clean.

My life would be completely different without clean, sanitary water. For example, I wouldn’t be able to take a nice bath or brush my teeth. I wouldn’t be able to make certain foods or take care of myself.

Read the passage.
The First "Newspaper" War
The Crimean War was fought in the 1850s between Russia on one side and Britain, France, and Turkey on the other. Although it was a major conflict, it is perhaps best remembered as the first war in which journalists were present on the battlefield. News dispatches from William Howard Russell, a reporter for the Times of London, exposed military blunders and revealed the filthy conditions that existed in military hospitals and camps. Photographers such as James Robertson and Roger Fenton made hundreds of photographs of soldiers on the battlefield. These news reports and photographs provided an uncensored look at life on the frontlines. The Crimean War marked the first time in history that people back home were exposed to the horrors of war.

What is the main idea of the passage?

The Crimean War was the first to be the war to be documented for civilians,

The Crimean War was fought between the Russians and the British, French, and Turkish.

Answers

It's about a war happened in 1850s between the Russia on the other side and the OTHER COUNTRIES was on the other side

|                                          |

| RUSSIA   <|>  Other Cs. |

|                                          |

I don't know if this helps....

But I'm heck sure sure.. It does not.

Answer:

The crimean war was the first war to be documented for civilians.

Explanation:

Which one plz explain
When you are trying to identify a story's theme, you look mainly at the story's: plot setting character all of the above

Answers

Mainly plot but all of the above also works the theme come from the lessons that are within the story what the characters go threw and what they learn can be or can influence the plot the best choice is all of the above

I once pronounced the state/word Utah as ¨Uh-Tah¨..... wow.
How do you pronounce the word Chiaroscurist?

Answers

Chi are o sor ust hope this helps :)

One effect of the inns and guesthouses appearing along the Silk Road routes was —
A. archaeologists began to visit the Silk Road
B. a large missionary network was established for Catholic priests
C. caravans no longer spent days or weeks traveling without stopping
D. trading networks in China increased as more traders traveled there

Answers

Answer: D

i think its d because when more people traveled there.. that would mean that more people were there.. which meant more crowded.. and more crowded meant more people.. and more people meant there was a need for more places to stay.

The answer is letter D

I WILL GIVE BRAINLIEST


does anyone have a good recipe for a mixed berry and yogurt parfait?

this is for English class and I've been craving one lol

Answers

1/3 cup low-fat plain yogurt

1/3 cup fresh or frozen mixed berries

1 tablespoon maple syrup

1 tablespoon of granola (dosen't matter what kind go with what you want)

fill a 6 oz container with a third of the yogurt then top with the berries, then drizzle with a little bit of maple syrup. repeat 2 more times then put it in the fridge until its cold. then mix the granola in with your parfait when your ready to eat it and boom. you have yourself a good parfait!

hope this helps :)

That sounds good really good need to try this

Read the passage.

A Flag with 50 Stars

The first American flag to have red and white stripes and white stars on a blue field was flown in 1776, shortly after the United States declared its independence from Great Britain. Legend has it that a Philadelphia seamstress named Betsy Ross was hired by George Washington himself to create this flag. There is no evidence that this legend is true, and no one knows for certain who made the first flag, which had 13 stars and 13 stripes. However, we know for a fact that the first flag to have 50 stars—the one we have today—was designed by a high school student.

In 1958, Bob Heft was a 17-year-old student at Lancaster High School in Ohio. At that time, the United States had only 48 states but was on the verge of accepting two more: Alaska and Hawaii. The U.S. flag at the time had six neat rows of eight stars each. What would be the best way to add two more stars while keeping the arrangement neat and orderly? This was the question that Bob’s history teacher posed to the class.

The teacher gave the students an assignment: design a flag with 50 stars. Bob spent hours in the attic of his house, cutting up a 48-star flag and rearranging the stars until they fit just right. He was pleased with his solution to the problem, but his teacher found it less than perfect and gave him a B minus. Outraged, Bob told his teacher that he was going to send his design to his member of Congress, Walter Moeller. His teacher replied that if Bob’s design was accepted as the new flag, he would be more than happy to change his grade to an A.

A year later, Bob had graduated and was working as a draftsman when he received a call at work. He never would have imagined a call from President Eisenhower—but that's who it was! Now that Alaska and Hawaii had been admitted as states, Congressman Moeller had succeeded in having Bob's design chosen as the new U.S. flag. Bob Heft was invited to Washington, D.C., for a ceremony during which his design was officially adopted as the new flag of the United States.

Question 1
Part A

What inference can be made about Bob Heft in “A Flag with 50 Stars”?


He has important connections to government officials.


He works hard and does not give up easily.


He is accustomed to success and does not take criticism well.


He is more knowledgeable about American history than most students.

Question 2
Part B

Which evidence from the text best supports the answer in Part A?


“Bob spent hours in the attic of his house, cutting up a 48-star flag and rearranging the stars until they fit just right.”

“He was pleased with his solution to the problem, but his teacher found it less than perfect and gave him a B minus.”

“Now that Alaska and Hawaii had been admitted as states, Congressman Moeller had succeeded in having Bob's design chosen as the new U.S. flag.”

“His teacher replied that if his design was accepted as the new flag, he would be more than happy to change the grade to an A.”

Answers

Answer:

He works hard and does not give up easily.  and “Bob spent hours in the attic of his house, cutting up a 48-star flag and rearranging the stars until they fit just right.”

Explanation:

give brainleist for answers

Answers

Answer:

Conservation of water is important

Explanation:

The Earth might be in trouble if not helped so therefore conservation of water will help Earth more so all of us will not get dehydrated

There are several affairs that take place throughout the course of the novel. Consider the marriage of the King and Queen, Monsieur and Madame Bonacieux, and Athos and Milady. What is the view of marriage in The Three Musketeers? Write at least three sentences.

Answers

Answer:

Explanation:

Anger. Dissapointment. Primarily disgusted

PLEASEE HELPP, NO LINKS AND DONT ANSWER JUST FOR POINTS OR YOU WILL BE REPORTED! Will give brainiest!

P.S: I think the answer is b but I’m not sure so please help.

Answers

Answer:

it is b!

Explanation:

EXPERT HELP:Caleb throws a ball three times for his dog Leo. For each throw, Leo either

catches the ball or misses it. Identify the sample space (the correct list of

possible outcomes) for the results.

C = catch, M = miss

The notation CMC means Leo caught the first ball, missed the second one,

and caught the third one.

A. {CCCC, CCMM, MMMM}

B. {CCC, CCM, CMC, MCC, MMC, MCM, CMM, MMM}

C. {CCC, CMC, MMM}

D. {CC, CM, MC, MM}

Answers

Answer:

A or C

Explanation:

I think that bc he threw it so that mean he is more likely to catch than miss or other way arond. SOrry if im wrong

I think the right answer is letter C

Please give me claims that go with the topic Racial Injustice I will report the answer if it isn't helpful

Answers

Answer:

Emmett Till

Explanation:

He was wrongfully accused of harassing and attacking a white woman so her husband and friend killed him..later reports say all he did was whistle.

Answer:

Martin Luther King Jr. He was arrested several times while voting for voting rights for blacks.

Explanation:

Select your own metaphors to complete a couplet. Remember to ask yourself what each reminds you of.

An acrobat swinging through the air,

Answers

Answer:

The moonlight sparkled brighter than a gypsy

Explanation:

This is a metaphor bc it compares 2 things without using like or as

Other Questions
Please answer these questions and I swear I will give you brainlist I promise I will answer this question part a and part b please What is the length of the missing leg?45 and 36 Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) What is Isolated system How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air Can I have some help with this math? Pls hurry, I will mark brainliest Evaluate the expression 4 25 . I have to find the missing angles In what Century did people learn how traits pass from one living being to itsdescendants? Find the sum or typeimpossible"Help Resources[1 -2 1] + [4 -5 -6]Skip[[?]Enter Texas Roadhouse opened a new restaurant in October. During its first three months of operation, the restaurant sold gift cards in various amounts totaling $1,800. The cards are redeemable for meals within one year of the purchase date. Gift cards totaling $728 were presented for redemption during the first three months of operation prior to year-end on December 31. The sales tax rate on restaurant sales is 4%, assessed at the time meals (not gift cards) are purchased. Texas Roadhouse will remit sales taxes in January.Required:a. Record (in summary form) the S3,500 in gift cards sold (keeping in mind that, in actuality, the firm would record each sale of a gift card individually). b. Record the S728 in gift cards redeemed. c. Determine the balance in the Deferred Revenue account (remaining liability for gift cards). HEY CAN SOMEONE HELP ME WITH MY LASTEST MATH QUESTION I WILL GIVE BRAINLIST PLEASE :))) The owner of Chips etc. produces two kinds of chips: lime (L) and vinegar (V). He has a limited amount of the three ingredients used to produce these chips available for his next production run: 4800 ounces of salt, 9600 ounces of flour, and 2000 ounces of herbs. A bag of lime chips requires 2 ounces of salt, 6 ounces of flour, and 1 ounce of herbs to produce; while a bag of vinegar chips requires 3 ounces of salt, 8 ounces of flour, and 2 ounces of herbs. Profits for a bag of lime chips are $0.40, and for a bag of vinegar chips $0.50. geometry ^please help me Match the western nations to their coloniesUnited StatesFranceGreat BritainThe Netherlands