How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT

Answers

Answer 1

Answer:

The number of repeats within an STR is referred to as an allele. For instance, the STR known as D7S820, found on chromosome 7, contains between 5 and 16 repeats of GATA. Therefore, there are 12 different alleles possible for the D7S820 STR.


Related Questions

Brown v. Board, Main points, argument, and violations. I am expecting a decent paragraph! (10 Sentence!) Majority Opinion for the brief also!

Answers

Answer:

The Supreme Court's opinion in the Brown v. Board of Education case of 1954 legally ended decades of racial segregation in America's public schools. Originally named after Oliver Brown, the first of many plaintiffs listed in the lower court case of Brown v. Board of Education of Topeka, KS, the landmark decision actually resolved six separate segregation cases from four states, consolidated under the name Brown v. Board of Education. While the attorneys originally argued the cases on appeal to the Court in 1952, the featured document, School Segregation Cases - Order of Argument, offers a window into the three days in December of 1953 during which the attorneys reargued the cases.

A reargument was necessary because the Court desired briefs from both sides that would answer five questions, all having to do with the attorneys' opinions on whether or not Congress had segregation in public schools in mind when the 14th amendment was ratified. The document lists the names of each case, the states from which they came, the order in which the Court heard them, the names of the attorneys for the appellants and appellees, the total time allotted for arguments, and the dates over which the arguments took place.

The first case listed, Briggs v. Elliott, originated in Clarendon County, South Carolina, in the fall of 1950. Harry Briggs was one of twenty plaintiffs who were charging that R.W. Elliott, as president of the Clarendon County School Board, violated their right to equal protection under the fourteenth amendment by upholding the county's segregated education law. Briggs featured social science testimony on behalf of the plaintiffs from some of the nation's leading child psychologists, such as Dr. Kenneth Clark, whose famous doll study concluded that segregation negatively affected the self-esteem and psyche of African-American children. Such testimony was groundbreaking because on only one other occasion in U.S. history had a plaintiff attempted to present such evidence before the Court.

Explanation:

A(n) ___ is a type of microscope that can analyze the characteristic glow of different fibers.

Answers

Is it a fluorescence microscope ?

What can people do if they feel that a law is unfair?

Answers

People who think that the law is not fair can approach the court to decide on the issue. The court has the power to modify or cancel laws if it finds that they don't adhere to the Constitution.
hope this help!

Answer: People who think that the law is not fair can approach the court to decide on the issue. The court has the power to modify or cancel laws if it finds that they don't adhere to the Constitution.

Essay on civil and criminal laws on malaysia?

Answers

Answer:

are various definitions of the term “legal system”. A Legal System is the framework of rules and institutions within a nation regulating individual’s relations with one another and between them and the government.(Book) In this world, there are many types of legal systems, but the few major legal sytems of the world today are civil law, common law, customary law, religious law, socialist and mixed law systems.

Civil law is the dominant legal tradition today in most of Europe, all of Central and South America, parts of Asia and Africa, and even some discrete areas of the common-law world, like Louisiana and Quebec. The origin of civil law is from the Roman law. The civil law is a set out of comprehensive system of rules which are applied and interpreted by judges. Besides that, civil law is older, more widely distributed and in many ways more influential than the common law.

Common law is a system of law that is derived from judges’ decisions, rather than statutes or constitutions. It is based on tradition, past practices and legal precedents set by courts through interpretation of statues, legal legislation, and past rulings.It is english origin and is found in United States and other countries with strong english influences

Customary law is a traditional common rule or practice that has become an intrinsic part of the accepted and expected conduct in a community, profession, or trade and is treated as a legal requirement. Not many countries in the world today will operate under a legal system which could be wholly customary. However, customary law still plays a sometimes significant role, like in the matters of personal conduct, in many countries or political entities with mixed legal systems.

Islamic law is derived from the interpretation of the Koran. Its primary objective is social justice, but also includes property rights, economic decision making, and types of economic freedom. Islamic law is mostly found in Pakistan, Iran, and other Islamic states.

Socialist law is based on fundamental tenets of Marxist-socialist state and center on concept of economic, political, and social policies of the state. It can be found in some independent states of the former Soviet Union, China and other Marxist-socialist states.

A mixed legal system is a mixture of two or more legal system practised by some countries.

2.0 Malaysia’s Legal System

Different country practices different types of legal system. Some country practices one type of legal system while others practices the mixed legal system which means a combination of two or more legal systems. Malaysia for example, practices the mixed legal system which includes the Common Law, Islamic law and Customary Law. Malaysia’s legal system comprises laws which have arise from three significant periods in Malaysian history dating from the Malacca Sultanate, to the spread of Islam to Southeast Asia, and following the absorption into the indigenous culture of British colonial rule which introduced a constitutional government and the common law. Malaysia’s unique legal system is designed to balance the delicate racial and religious needs of its heterogeneous people. The Malaysian legal system law can be classified into two . However, according to the democratic ruling system, the Chief Executive is the Prime Minister. This does not mean that the Yang di-Pertuan Agong is unable to voice any opinion, but rather that he must act on government advice, whatever his personal view might be. The Yang di-Pertuan Agong appoints a Cabinet to advise him on country’s matter. The Cabinet consists of the Prime Minister and a number of Ministers who must all be members of Parliament. Besides that, the Government has set up various agencies to ensure the smooth enforcement of the law. It comprised of three main components, namely ministries, departments and statutory bodies.

laws pertaining to persons professing the religion of Islam.

Share this:

Cite This Work

To export a reference to this article please select a referencing stye below:

OSCOLA

APA

MLA

MLA-7

Harvard

Vancouver

Wikipedia

All ltd, 'L

Trustedsite Law

Other Questions
In the earliest days of Greece,Aall the Greek people spoke the same dialectBthe country was divided into small city-statesCeveryday life was relaxed and easyDno one wrote stories, plays or myths A persons genotype is pp. p=five fingers. What is this persons phenotype? what is the absolute value of -l8| is 5 meters bigger or 1,300 centameters Why did the need for public defenders increase following the Supreme Court's decision in Gideon v. Wainwright?a. There were too many prosecutors and not enough attorneys for cases at this time.b. Criminal defendants in felony cases were required to be provided counsel by the state if the defendant could not afford his or her own legalrepresentationc. Requests for legal defenders had been piling up and not addressed until this time.d. The accused began studying the law and learning to defend their rights. Which statement explains the type of function that is represented by the equationy=x2 +9? 5Select the correct answer.Which type of investment offers both capital gains and interest income?.propertyOB.CDs.stocksODbondsPlato help me out? :) don't guess, if u dont know just dont answer. NO LINKS. In which of these can convection not occurA. GasesB.solidsC.liquidsD.fluids A study was conducted to investigate whether there are regional differences in peanut butter preference in the United States. The country was divided into 7 geographic regions, and in each region a random sample of peanut butter eaters were asked whether they preferred creamy or crunchy peanut butter. The responses were summarized in a 7-by-2 table of counts for each combination of geographic region and creamy or crunchy peanut butter preference. Which of the following tests is the most appropriate for the investigation? Solve for v and put your answer in simplest radical form. Show steps plz!r = stu/v^2 The tendency of a cell or an organism to maintain a stable internal environment is known as _______. A. homeopathy B. homology C. homogeneous D. homeostasis 2. Carbon has many benefits in an ecosystem. List three helpful ways carbon is usedby humans, plants, and other species:1)2)3) PLEASE HELP!! Ill MAKE BRAINLIEST PLEASE HELP!!!!Category:Which of category does this poster fit in and why? ARGUMENT OR PERSUASIVEAudience: Who is the intended audience of the poster? Message: What is the posters message? Images: How does the artist use symbols, images, shapes, space, and color?Text: How does the artist use words?Facts: What facts and details do the poster images and text present? Argument or Persuasion Do you think is using argumentation or persuasion? Why? Which of the following is NOT a benefit of colonialism?A: Unity of Social CustomsB: Education C: Modern Technology D: Railroadsthis is a exam plz help :) Hii! I really need help on this with the spree that answers! For 30 points. I dont wanna waste my points so make sure your answer is right. In a sample of neon, carbon, and oxygen gas, the total pressure is 9 atm.The partial pressure of neon is 2 atm and the partial pressure of oxygen is 2atm. What is the partial pressure of carbon?9 atm3 atm5 atm4 atm Which of the following prevents one branch of government from becoming too powerful?abthe Supremacy Clausethe separation of church and statethe separation of powersthe Bill of RightsC d Adam bought 6 yogurt cups for $8. Which of the following represents a higher unit rate than what Adam paid? a. 4 yogurt cups for $6 b. 8 yogurt cups for $10c. 10 yogurt cups for $12 d. 12 yogurt cups for $14 Que es un advervioplis ayuda