Which part of the US developed the most cities?

Answers

Answer 1

Answer:

1.  fort myers, Fl

2. Bend, OR

3. Meridian, ID

4. Milpitas, CA

Answer 2

Answer:

East coast

Explanation:


Related Questions

Any 5 points to change bad habits to good habits​

Answers

Answer:

Explanation:

1. Write down how your going to fix it 2. brainstorm what got you there in the first place it may give perspective on how to stray away from the bad habit 3. Simply execute and use an all or nothing mindset 4. Use better language when referring to your goals i.e. instead of ill try say I will. 5. make a commitment to yourself.

I have a question about civics.

What is the best government for the most people in a sovereign nation and why?

What would democracy look like? Where is the power in a democracy? (draw the power structure/branches of government)

Answers

The federal government is the best government for people and sovereign nations because the federal government is divided into three branches these are the legislative, the executive and the judicial branch. Each branch has its own rights and powers which are meant to check and balance the powers of each other branch.

what are 3 ways people have adapt in Southwest Asia and North Africa with the lack of water?

Answers

Answer:

They learned how to save water and to use it wisely so you can have it longer.

Explanation:

dont ask ok people this is not for u so dont ask

Answers

Answer: ok i wont ask

Explanation:

Answer:

I wont ask but i want to but i wont

Explanation:

Which phrase appears in the preamble of the Florida Constitution, but not the United States Constitution?

Answers

Answer: "We the People"

Explanation:

Cuz Glizzy is what they needed

CAN SOMEONE HELP ME PLEASE?

answer choices:

(1) popular sovereignty
limited government
the rule of law

(2) presidents
legislation
people

(3) rule of law
representative government
limited government

(4) the separation of powers
personal liberties
representative government

Answers

Answer:

1: 4

2: 3

3: 1

4: 2

Explanation:

Which of the following is a benefit of mining in Canada?
Group of answer choices

Sulfur dioxide is sent into the air as pollution.

Over 1.5 million people have jobs in the mining industry.

Waterways are polluted from mining

Valuable mining lands are located in Alaska.

Answers

Answer:

Over 1.5 million people have jobs.  Mining is one of the best forms of employment for non-college educated workers in the civilized world.

Explanation:

please help and thank you ​

Answers

Answer:

2. 1961

The first U.S. astronauts were a magnificent seven—military test pilots all, three Air Force, three Navy, one Marine—designated to fly Project Mercury capsules into space, then land them back on Earth. When the seven were selected in 1959, no one had ever come close to leaving our planet's atmosphere—and no one knew exactly what might happen if they actually succeeded.

3. Moon

The moon go round the earth.

4. Hubble Space Telescope

The Hubble Space Telescope is a large telescope in space. NASA launched Hubble in 1990.

5. sorry don't know

Explanation:

Hope it is helpful....

how did lonnie johnson's accomplishments impact the general public

Answers

Answer:

He invented the Super Soaker water gun in 1990, which has been among the world's bestselling toys ever since. He also invented the Nerf Gun when he patented "a pneumatic launcher for a toy projectile" which revolutionised toy blasters.

Explanation:

Brainly?

how do you write in abc order.​

Answers

so it’s z y x w v u t s r q p o m n, l k j i f g, f e d c b a! hope this helps ‍❤️‍‍

Drag each tile to the correct box.

Match the political leaders to their descriptions.

Adolph E. Borie
James A. Garfield
General Ulysses S. Grant
George S. Boutwell
secretary of navy; donated money to the Republican
candidate’s campaign during the presidential election
of 1868
arrowRight
secretary of treasury; advised the president about the
Black Friday scandal, and solved the financial panic
arrowRight
was accused of participating in the Crédit Mobilier scandal;
later became president of the United States in 1881
arrowRight
the first elected president of the United States
after the Civil War
arrowRight

Answers

Answer:

secretary of treasury; advised the president about the

Black Friday scandal, and solved the financial panic- George S. Boutwell

secretary of navy; donated money to the Republican

candidate’s campaign during the presidential election

of 1868- Adolph E. Borie

the first elected president of the United States

after the Civil War -General Ulysses S. Grant

was accused of participating in the Crédit Mobilier scandal;

later became president of the United States in 1881- James A. Garfield

Explanation:

help me please and thank you

Answers

Answer:

the formula D is not correct

What was the long-term impact of the Punic Wars? (14 points) no link
a
They allowed Spain and Gaul to gain their independence.

b
They forced Carthage to become an ally of Rome.

c
They made Rome the dominant power in the Mediterranean.

d
They brought lasting peace to the Mediterranean world.

Answers

Answer:

The answer is C

Explanation:

The origin of the conflicts arose with the position that Rome acquired as protector and leader of Italy.

Alaska and Texas

Alaska has a very cold climate. Snow covers much of the land during the year. Alaska is the biggest state in the United States. Alaskans must wear very warm heavy clothing to keep them from getting cold. Alaska has many different types of wildlife.

Texans enjoy a mild climate. They have mostly warm weather. Texas is the second largest state in the United States. For most of the year, people in Texas can wear light or cool clothing. Like Alaska, Texas is also home to many different types of wildlife.

A Venn diagram is pictured with the words “Alaska” and “Texas.” The space where the two circles overlap reads: Both.
Use the passage to answer the question.


Alaska and Texas are alike because

A. they both have cold weather climates.
B. they both have mild climates.
C. they are both states that get lots of snow.
D. they are both states in the United States.

Answers

Answer:

it is D

Explanation:

They are both part of the United States

Answer:

D

Explanation:

Repent while there’s still time. Love while you still can. Give till there’s nothing left. Serve with all you’ve got. Go while you’re still able. Share all that you have. Follow hard after God. Live with no regrets. Time is of the essence. If we only have today, there’s still time. Don’t miss this time. Look yourself in the mirror and ask your self - If I died today, would the Lord judge me worthy of eternal life? If the answer is no, then ask him for forgivness. As long as you are really sorry, he will forgive you. If you want to talk, I am here. If you need time alone, then I will leave you alone. If you need a Bible, I can get you one. Follow your heart and never stop doing good. Thank you for reading this, and have a great day. May the good Lord bless you, your family, and the world.

"The fear of the LORD is the beginning of wisdom, and knowledge of the Holy One is understanding." - Proverbs 9:10

What was the long-term impact of the Punic Wars? (14 points)

a
They allowed Spain and Gaul to gain their independence.

b
They forced Carthage to become an ally of Rome.

c
They made Rome the dominant power in the Mediterranean.

d
They brought lasting peace to the Mediterranean world.

Answers

Answer:

c

They made Rome the dominant power in the Mediterranean.

Both the moon and the sun influence the tides on earth. The moon has a much greater influence though. why is that?

Answers

Answer:

Based on its mass, the sun's gravitational attraction to the Earth is more than 177 times greater than that of the moon to the Earth.Therefore, the sun's tide generating force is about half that of the moon, and the moon is the dominant force affecting the Earth's tides.

Explanation:

Which of the following was a result of the Soviet Union testing nuclear weapons?

1) American began peace talks with the Soviet Union

2) Americans began to build fallout shelters in case of a nuclear attack

3) the government built up military technology to defeat nuclear missiles

4) America became isolationist to focus on defense of the country.

Answers

Answer:

4 is answer i think if wrong dont report me pls

HELP WILL MAKE BRAINLY
Which of the following IS TRUE about tribute and the encomienda system?
a
It made the encomienda system easier for indigenous peoples.
b
It made the encomenderos less powerful.
c
It made inequalities in the encomienda system worse for indigenous peoples.
d
It was a win-win. Idigenous people got to do valuable work and encomenderos made money.

Answers

Answer:

Explanation:

Encomienda, in Spain's American and Philippine colonies, legal system by which the Spanish crown attempted to define the status of the indigenous population. ... It was based upon the practice of exacting tribute from Muslims and Jews during the Reconquista (“Reconquest”) of Muslim Spain.

Take what i gave you to answer... HINT: B

Describe the evolution of rations as described in the video, making sure to discuss at least two major eras of ration use. The future era is acceptable.

Answers

The first major era of ration used was in World War II where  they used rations as an easy meal they can carry in their backpack. The second major  era was in Vietnam were they used sea rations that had all the food groups in it.

Which of the following best describes the message of the old man who fell into the river?
Don't walk to close to the edge of the river
Go with the flow
Hold your breath and things will work out.
take swimming lessons: you never know when you might need them.

Based on taoism and i really need help

Answers

Answer: Go with the flow. The old man says after coming out alive, "I accommodated myself to the water,

not the water to me.

Without thinking,

I allowed myself to be shaped by it.

Plunging into the swirl, I came out with the swirl.

This is how I survived."

Jill is an excellent technical writer. She has never missed a deadline and all her projects are of superior quality. She now wants to telecommute two days a week, so that she can spend more time with her family. She feels that she has proven her reliability. However, her boss is unable to comply with her request and gives her a substantial raise instead. Jill's disappointment demonstrates a breakdown in the ________ relationship

Answers

Answer:

rewards-personal goals relationship

Explanation:

Rewards-personal goals relationship refers to the level to which the satisfaction of the rewards given by an organization helps in maintaining the personal needs of the employee. The rewards given by the organization helps in motivating the employees in some way that in turn helps in improving the quality of work done by them.  

In the given situation, the reward that Jill wanted from her company was time. She wanted to use that time to build a healthy relationship with her family. In turn her boss offered her an increment in her salary. This action highlights the disappointment that Jill faced in a breakdown in the rewards-personal goals relationship.  

A combat engineer’s job includes constructing bridges to allow troops to move.

True
False

Answers

Answer: True

Explanation:

Im not 100% sure but I think its true.

what can be measured by acceleration

Answers

Answer:

Acceleration is a measure of the change in velocity of a moving object. its c

Explanation:

How many slave state remained in the Union

Answers

Answer:

4 slave states stay in the union.

Answer:

4 slave states

Explanation:

Although divided in their loyalties a combination of political maneuvering and Union military pressure kept these states from seceding.

Which statement is true about levels of organization in organisms

a.Organ systems function alone.
b. organs cannot be found in plants
c. tissues are found in single-celled organisms.
d.Cells perform location-related functions in the body

Answers

I think the answer is C

Atoms, molecules, organelles, cells, tissues, organs, organ systems, and the human organism are the major levels of organisation in the body, going from the simplest to the most complex.

What are levels of organization in organisms ?

The body is organised at many stages that progress together. Organ systems are made up of tissues, which in turn are made up of tissues and organs. The coordinated activity of an organ system's organs determines how well it functions. To process food, for instance, the digestive system's organs work together.

Cells, tissues, organs, and organ systems are the four levels of organisation that make up an organism. These levels categorise intricate anatomical structures into categories, making the parts simpler to comprehend.

Organelle, cell, and organism are the biological levels of organisation of living things, in order from most basic to most sophisticated.organisms, populations, communities, ecosystems, tissues, organs, organ systems, and the biosphere.

The following levels can be used to group various types of creatures: cells, tissues, organs, systems, and organisms.

Learn more about  organisms here

https://brainly.com/question/12825206

#SPJ6

Below is a map of the Mediterranean world at the time of the Second Punic War. Use this map below to answer the following question:

Public Domain

Roman controlled areas are red and their allies are shaded pink. Carthage controlled the areas in dark blue, and its allies are shaded light blue.

Which conclusion can be drawn about the Second Punic War from the information in the map? (4 points)

a
Rome had established firm control of the Italian peninsula prior to the Second Punic War.

b
The Roman's allies played a key role in their victory on the Italian peninsula.

c
Rome was also at battle with the Carthaginians over territory in the Eastern Mediterranean.

d
Rome had enemies both on the Italian peninsula and in North Africa.

Answers

Answer:

c

Rome was also at battle with the Carthaginians over territory in the Eastern Mediterranean.

I’m giving brainlist for people who answer! (And a rating + like on your profile)

Answers

Answer:

1. A

2. tea

3. A

4. True

Explanation:

4. Quartering Act of 1774 Allowed new governor General Thomas Gage to house British soldiers in private homes, inns, and other buildings without permission from colonists.

sorry abt the 2nd question It may not be correct but hope some answers at least help

BONUS QUESTION PLESE ANSWER

Answers

Answer:

The government would give the indians food

Explanation: I took this in 6th grade

The last one, because I took this a couple years back

PLZ HELP UNIT TEST REVIEW 45 POINTS
Read the passage.

If you look at the stars . . . you will see those stars so minute that it would seem as though nothing could be smaller; it is in fact their great distance which is the reason of their diminution, for many of them are very many times larger than the star which is the earth with water. Now reflect what this our star must look like at such a distance, and then consider how many stars might be added—both in longitude and latitude—between those stars which are scattered over the darkened sky.

–"In Praise of the Sun,”
Leonardo da Vinci

Which evidence from the passage supports da Vinci’s conclusion that the size of the stars cannot be determined by how they appear in the sky?

“If you look at the stars . . . it would seem as though nothing could be smaller.”
“It is in fact their great distance which is the reason of their diminution.”
“Many of them are very many times larger than the star which is the earth with water.”
“Now reflect what this our star must look like at such a distance, and then consider how many stars might be added.”

Answers

Answer: hose stars so minute that it would seem as though nothing could be smaller; it is in fact their great distance which is the reason of their diminution, for many of them are very many times larger than the star which is the earth with water. that part

Explanation:

Da Vinci's conclusion that the magnitude of the stars cannot be judged by how they look in the sky is supported by the passage's evidence:

"It is indeed their immense distance which is the explanation of their decrease."

Therefore, option A is correct.

What are stars?

Stars are large celestial objects that emit light and heat through the process of nuclear fusion. They are formed from clouds of gas and dust, primarily hydrogen and helium, which collapse under the force of gravity. As the gas and dust collapse, they begin to heat up due to the release of gravitational potential energy, eventually becoming dense and hot enough for nuclear fusion to occur in their cores.

During nuclear fusion, hydrogen atoms combine to form helium, releasing vast amounts of energy in the process in the form of light and heat. This energy causes the star to shine and generates the radiation pressure that counteracts the force of gravity, keeping the star from collapsing in on itself.

This statement suggests that the stars may appear smaller in the sky due to their great distance from Earth, rather than their actual size being small. The statement implies that the size of the stars cannot be determined based solely on their appearance in the sky.

Learn more about stars here:

https://brainly.com/question/18426562

#SPJ3

1. Who wrote the Fihrist? What do we know about that person?

Answers

Answer: Ibn al-Nadim,  Ibn al-Nadīm was an Arab Muslim bibliographer and biographer of Baghdad who compiled the encyclopedia Kitāb al-Fihrist.

Ibn al-Nadim, also known as Ibn al-Nadim, was a Baghdad-based Arab Muslim bibliographer and biographer who created the Kitb al-Fihrist encyclopaedia.

What do we know about Ibn Al Nadim ?

He passed away there on Shaban 20, A.H. 385, Wednesday, 320/932. He was perhaps Persian or possibly Arab.

He might have started attending a madrasa when he was six years old, where he could have obtained a thorough education in Islamic studies, history, geography, comparative religion, the sciences, language, rhetoric, and Qur'anic interpretation.

He completed an apprenticeship in the book trade, the line of work of his father.

Al-Nadim was hired by his bookdealer father, who also owned a successful bookstore, to purchase manuscripts from sellers.

Al-Nadim would subsequently replicate them for the clients with the help of the other calligraphy scribes on staff.

The bookshop would have been a favourite gathering place for intellectuals, typically located on an upper floor.

For more details about Muslim leader to refer link

https://brainly.com/question/24286903

#SPJ5

Other Questions
Plz help me Im begging plz what is the mRNA in TACCGGATGCCAGATCAAATC? pinocchio says my nose will grow. will it grow or not?dun dun dun what is (-10,10) if i dilate it by 1/2 a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. HELP MEEE BRAINLIEST do this for me? helppp all my point I need help please!! Suppose we want to choose 3 objects, without replacement, from the 4 objects pencil, eraser, desk, and chair.(a) How many ways can this be done, if the order of the choices is relevant??(b) How many ways can this be done, if the order of the choices is not relevant? DUE RIGHT NOW PLEASE HELP!!!!! Clasifica cada uno de los siguientes incisos como sustancia pura (elemento y compuesto) o mezcla (homognea y heterognea). Explica brevemente. (a) arroz con leche (b) agua de mar (c) magnesio (d) gasolina ?????????????????????????? What does an individual's effective tax rate indicate?A.the average income earnedB.the average tax rateC.the minimum tax rateD.the next year's tax rate need help please hurry the person above me is usless Lines a and b are parallel. The slope of line b is 1/3 . What is the slope of line a? Which of these are part of the electromagnetic spectrum?Question options:gamma raysvisible lightmicrowavessound wavesradio waves Compare and contrast an acronym and an abbreviation?