what is the mRNA in TACCGGATGCCAGATCAAATC?

Answers

Answer 1

Answer:

AUGGCCUACGGUCUAGUUUAG


Related Questions

when are chromosomes (dna) copied?​

Answers

Answer:

Interphase begins with G1 (G stands for gap) phase. During this phase, the cell makes a variety of proteins that are needed for DNA replication. During S phase, which follows G1 phase, all of the chromosomes are replicated. Following replication, each chromosome now consists of two sister chromatids.

Have a good day. :)

Answer:

Chromosome replication

Explanation:

Chromosome replication is a key event during the cell cycle that must be completed before a cell divides. To reproduce successfully, every cell must replicate its chromosome and distinguish these sister chromosomes from one another.

islfso lufe
(Hint: a non-renewable resource, like coal)
CHAPTER
1 what is the term?

Answers

Answer:

Fossil fuel

Explanation:

explain how at least three pieces of evidence support the theory of evolution.

Dont put any link or else I won’t give brainlist, just answer.

Answers

Answer:

1. Fossil evidence

2. Homologous similarities.

3. Molecular evidence

Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.

_____ Motor neurons cause muscles to contract so the body can react to the stimulus.

_____ The brain processes the information through interneurons.

_____ Interneurons transfer response information to motor neurons.

_____ Sensory neurons carry stimulus information to the brain or spinal cord.

Answers

Answer:

The correct answer is -

1 - The stimulus is received by sensory receptors.

2 -  Sensory neurons carry stimulus information to the brain or spinal cord.

3 -  The brain processes the information through interneurons.

4 -  Interneurons transfer response information to motor neurons.

5 - Motor neurons cause muscles to contract so the body can react to the stimulus.

Explanation:

In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.

These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.

why is it important to save energy in our daily lives

Answers

Answer:

So you can be more active and do different things that need energy

Explanation:

Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.

The energy that powers photosynthesis comes from
A. oxygen.

B. water.

C. the sun.

D. chemicals.

Answers

Answer:

sun but am not so sure about it

The Rio Grande River separates Mexico from Texas.

What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion

Answers

Answer:

d I think or b?

Explanation:

water could cause it to form a river and spread over time

what are the differences between ligaments & tendons

Answers

Basically ligaments connect and tendons bridge

3. Which of the following statements best explains how the cell membrane 1 point
is selectively permeable? *
The movement of specific substances into and out of the cell is controlled by the cell
membrane
The movement of waste substances into, but not out of the cell is controlled by the
cell membrane
The cell membrane is inflexible and cannot control the movement of substances into
and out of the cell
The cell membrane does not surround the cell so it plays no role in the movement of
substances

Answers

Answer:

The movement of specific substances into and out of the cell is controlled by the cell membrane.

Explanation:

The cell membrane is permeable, so it allows for the passage of substances both into and out of the cell. It is also selective, so only specific substances can enter and exit the cell.

This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?

Answers

Answer:

Carbon dioxide, water and sunlight

Answer:

water and sunlight

Explanation:

Other Questions
Which statement accurately describes how the population of Texas has changed since the 1980s?A) The population has decreased slightly.B) The percentage of minorities has declined C) The population has increased dramatically D)The percentage of older people has grown simply I can't find the answer anywhere!"What does it mean when a person has 'limited resources?"I tried to find it in the article given to me (in the picture) but it only mentions limited resources once. HELP ASAP PLSWhat wish did Zeus grant Eos???? Surface area formula of a parallelogram prism Over-farming and the changed the face of farming on the Great Plains which caused Floods - high lake levels Drought - Increased home sales Drought - The Dust Bowl La Nina - the cruise ship Please help! If you do you will get 'Brainliest' One angle of a triangle measures 95 the other two angles are in a ratio of 7:10 what are the measures of those two angles What is P(3 or divisor of 24)? Give the correct question that goes with the following answers ZABD and ZDBC are supplementary angles.What is the measure of x?X = [?]AK170%B- Complete the factorization of 3x2 5x + 2. List some of the external problems that China faced during the 1800s. Which expression is equivalent to (6^-2)^3 A factory owner might decide to manufacture shirts in Pakistan instead of the United States because A. it is less expensive to make shirts there.B. it is worth paying more for foreign labor.C. workers in Pakistan are more skilled.D. workers in Pakistan work fewer hours. A sociologist recorded the number of contacts entered in a cell phone and the number of texts sent in a week for 20 cell phone users. The resulting data were used to conduct a hypothesis test to investigate whether there is a linear relationship between the number of contacts and the number of texts sent. What are the correct hypotheses for the test?a. H0:1=0 Ha:10b. H0:1=0 Ha:1>0c. H0:1=0 Ha:1 Convert 25.4 grams of barium phosphate, Ba3(PO4)2 to formula units. a solution of KCl in water has a concentration of 0.243 M. The solution has a volume of 0.580 L. How many grams of KCl are present in the solution? In one paragraph, using your own words, define the term observations, describe two different types of observations, and explain how observations can be helpful in a discussion. reflexin sobre los factores de la disciplina Hadi randomly pulls a sock from a drawer with 3 patterned socks, 6 gym socks, 7 striped socks, and 4 red socks. What isthe probabilty that Hadi does not choose a red sock?