Which option is used to determine whether information that should remain private is included in the final version of a PowerPoint presentation?
Compatibility Check
Grammar Checker
Document Inspector dialog box
Trust Center

2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Help!!! I do not seem to understand this problem well. Why would an investor want to choose a certificate of deposit over a corporate bond describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver I will mark Brainliest for frist answer This Question: 1 pt20 of 20This QuthThe pH of a fruit juice is 2.9. Find the hydronium ion concentration, [H30 * ), of the juice. Use the formula pH = -log[H30*]The hydronium ion concentration [H30 + ] is approximately moles per liter.(Use scientific notation. Use the multiplication symbol in the math palette as needed. Round to the nearest tenth as needed.) A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size When riding your bike on a main road you should always follow the rules of the _________.roadbikers guidewalkerstown they are riding in Can someone please help me on this plz I beg u :( Please real answers. Marking brainliest.How did Gerald Ford become president of the United States?A. He was elected president in a special election.B. He was vice president when the president resigned.C. He was elected president following an election campaign. D. He was appointed by Congress after the president was impeached. Writing: Critique On Nutrition And Pregnancy. Critique a current article or website on Pregnancy and compare to good nutrition practices. 1) Evaluate the recommendations. 2) Compare the recommendations. Write a 300 or more on your findings and conclusions. ( Will Mark Brainliest).