Which of the following is a molecule with more than one element?
O Atom
O Bacteria
O Compound
Organism

Answers

Answer 1

Answer:

compound

Explanation:

as cited from coolgalapagos.com, "Molecules made of more than one kind of element are called compounds. A compound is formed when one kind of atom (an element) joins to at least one other kind of atom of a different element."


Related Questions

What are the factors that determine

the level of harm an introduced chemical

has on the enviroment?


PLEASE ANSWER QUICKLY

Answers

The factors that determine the level of harm an introduced chemical has on the environment depends on the type of chemical it is, the concentration of the chemical, and weather conditions that are occurring at the time that the chemical was introduced( like air pollution) ( acid rain) ( deforestation) ( desetfication)

What purpose does the endosperm serve in the seed?

Answers

Answer:

Supporting embryonic growth

Explanation:

The endosperm plays an important role in supporting embryonic growth by supplying nutrients, protecting the embryo, and controlling embryo growth by acting as a mechanical barrier during seed development and germination.

Answer:

Supporting embryonic growth

A small population will most likely

a. have plenty of food to eat. b. have exponential growth.
c. have plenty of space to live. d. All of these are correct.

Answers

Answer:

D. All of these are correct.

Marcus grew three rosemary plants. He put one in
direct sunlight, one in the shade, and one in the
dark. The plant in the sun grew the most quickly
and looked the healthiest. Marcus concluded that
rosemary plants grow best in the sun.
How would you evaluate Marcus's conclusion?
O A. His conclusion is valid because his
experiment included a control.
B. His conclusion is valid because he tested
only one variable.
O C. His conclusion is flawed because he did
not perform enough trials.
O D. His conclusion is flawed because it is
based on the appearance of the plants.

Answers

Answer:

His conclusion is flawed because he did

not perform enough trials.

Explanation:

i jus took the test

islfso lufe
(Hint: a non-renewable resource, like coal)
CHAPTER
1 what is the term?

Answers

Answer:

Fossil fuel

Explanation:

How can G and cloning be used in medical science

Answers

Answer:

for testing differnt cures on animals

Explanation:

An individual who exhibits a mixture of schizophrenic symptoms most likely has undifferentiated schizophrenia. Please select the best answer from the choices provided OT OF​

Answers

Answer:

True

Explanation:

An individual who exhibits a mixture of schizophrenic symptoms most likely has undifferentiated schizophrenia.

The most likely diagnosis for someone who displays a variety of schizophrenic symptoms is undifferentiated schizophrenia. The aforementioned is therefore True.

What is schizophrenia?

The illness that impairs a person's capacity for clear thinking, feeling, and behaviour is schizophrenia. Although the precise origin of schizophrenia is unknown, it is thought that a mix of genetics, environment, and changes in brain chemistry and organization may be at play.

Schizophrenia is characterized as disorganised speech or behaviour, depressed participation in daily tasks, and ideas or experiences that appear disconnected from reality. Memory loss and attention problems could also be present.

Therapy is typically ongoing and frequently consists of a mix of prescription drugs, psychotherapy, and well-coordinated specialty care services.

So, the given statement is True.

Learn more about Schizophrenia, here:

https://brainly.com/question/8611812

#SPJ7

THIS IS EARTH SCIENCE
PLEADE ASNWER THE Two QUESTIONS IN THE PICTURE

How do ocean currents affect the coastal regions of S.America at 20 degrees south latitude

When a lake freezes over. How does the energy content of the lake change?

Answers

Answer:

Explanation:The remaining air (air that does not descend at 30 degrees North or South latitude) continues toward the poles and is known as the westerly winds, or westerlies

Question: How do ocean currents affect the coastal regions of S.America at 20 degrees south latitudeAnswer: Warm and cold ocean currents can affect the climate of an area along the coast if the winds blow in from the ocean. Warm ocean currents heat the air above the water and carry the warm air to the land, increasing the temperature of the coastal regionQuestion: When a lake freezes over. How does the energy content of the lake change? Answer: Liquid water has more energy than frozen water. When water freezes it gives up some of the water's energy. This energy that is given up is the latent heat of freezing. When the water was freezing latent heat of freezing energy was being released(WATER IS THE LAKE)Bonus: I know that during melting, there is no temperature change as the heat energy is used to do work against potential bond energy but why doesn't temperature change when freezing? Freezing is the opposite process of melting. If the temperature does not increase as the ice melts, the temperature will not decrease as water freezes. Melting and freezing are entropy changes. Entropy measure the amount of disorder in a system. A system, like ice, which has less freedom of motion, has less disorder. A system, like liquid water, which has more freedom of motion, has more disorder. So water has more entropy than ice. Ice is a very ordered arrangement of H2O molecules in a crystalline form. As heat energy is added to ice, the energy is used the break the bonds between the H2O molecules in the ice crystals. So, the temperature remains constant. You might say that the energy that is added to the ice is used to increase the entropy of the system, instead of increasing the temperature of the system.-TAY brainly please

Without the process of translation, our cells would not be able to:
make DNA
make RNA
make amino acids
make proteins

Answers

Answer:

Make protein

Explanation:

Make protein by RNA

Trees in a temperate deciduous forest compete for all of the following EXCEPT -
A sunlight.
B shelter.
C soil.
D water.

Answers

Answer:

B

Explanation:

Trees needs sun, soil (nutrients), and water to grow and become strong.

I hope this helps ^-^

The answer is b hope this helps trees need soil water and sunlight to grow

Select the correct answer. A roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates. How much energy does the sandwich provide? A. 747 calories B. 542 calories C. 502 calories D. 367 calories E. 332 calories

Answers

Answer:

D. 367

Explanation:

If a roasted chicken multigrain sandwich contains 42 g protein, 7 g fat, and 34 g carbohydrates, it contains 367 calories of energy, hence option D is correct.

What is food energy?

Animals obtain the chemical energy known as "food energy" from their food in order to maintain their metabolism, which includes their muscular activity.

The majority of animals get most of their energy via aerobic respiration, which involves mixing carbs, lipids, and proteins with air or water-based oxygen.

To find the total calories, multiply the given biomolecules grams with their calorie count.

= 42 × 4 + 7 × 9 + 34 × 4

= 168 + 63 + 136

= 367 calories

Therefore, the sandwich provides 367 calories of energy, if it contains 42 g protein, 7 g fat, and 34 g carbohydrates.

Learn more about energy, here:

https://brainly.com/question/839331

#SPJ5

FOODS HIGH IN PROTEIN RELEASES ENERGY
A. FAST
B. QUICKLY
C. SLOWLY​

Answers

Answer:

quickly

Explanation:

Answer:

SLOWLY

Explanation:

HELP right now please! No websites

Answers

Carbon dioxide is the name of the molecule I believe
CO2. Carbon Monoxide

the process which takes place in guard cells but not in other epidermal cells is?​

Answers

Answer:

guard cells chloroplasts , involved in the photosynthesis where epidermal cells are living cells covering the outside surface of the herbaceous plants they contain a thick covering of cutting which reduces the water loss from Plants epidermal cells in roots are specialized for water and ion absorption don't know if it helped but good luck

Photosynthesis

The process by which green plants and some other organisms use sunlight to synthesize foods from carbon dioxide and water. The upper and lower epidermal cells do not have chloroplasts, thus photosynthesis does not occur there.

Difference in guard and epidermal Cells:

Two guard cells form a stoma, controlling the gas exchange of the plant by regulating the size of the stoma whereas epidermal cells provide a protection to the plant from the external environment.

Photosynthesis does not take place in epidermal cell because:

The epidermal cells that make up this skin are transparent. As most epidermal cells lack chloroplasts, they can't perform photosynthesis, or the use of sunlight to convert carbon dioxide and water into glucose and oxygen.

Learn more:

brainly.com/question/9498584

a black chicken and a white chicken are crossed. what is the probability of.

Answers

Answer:

25% that they would have a black chick

Explanation:

50% of the offspring have genotype BW, 25% are BB and 25% are WW. This means that 50% of the offspring are erminette, 25% are black, and 25% are white.

Hope this helps!!

when are chromosomes (dna) copied?​

Answers

Answer:

Interphase begins with G1 (G stands for gap) phase. During this phase, the cell makes a variety of proteins that are needed for DNA replication. During S phase, which follows G1 phase, all of the chromosomes are replicated. Following replication, each chromosome now consists of two sister chromatids.

Have a good day. :)

Answer:

Chromosome replication

Explanation:

Chromosome replication is a key event during the cell cycle that must be completed before a cell divides. To reproduce successfully, every cell must replicate its chromosome and distinguish these sister chromosomes from one another.

what is sodium E621 know as MSG is​

Answers

Answer:

MSG is short for monosodium glutamate. It is common food addictive-with the e-number E621 that is used to enhance flavor.

Explanation:

MSG is derived from the amino acid glutamate or glutamic acid, which is one of the most abundant amino acids in nature.

How are animals in the polar dying connected to climate change?
help

Answers

Answer: well, ce dependent species such as narwhals, polar bears, and walruses are at increasing risk with shrinking sea ice cover. ... As the Arctic loses snow and ice, bare rock and water absorb more and more of the sun's energy, making it even warmer. This is called the albedo effect.

Explanation:

what animal eats fiddler crabs?

Answers

Gulls, crows and herons are all opportunists. They'll eat just about anything that they can get their beaks on. That includes fiddler crabs.

Answer:

Predators that feed on fiddler crabs include herons, egrets and raccoons. At one to two years, the fiddler crab reaches sexual maturity.

Explanation:

which two layers of the atmosphere are responsible for the majority of solar radiation absorption?

Answers

Answer:

The stratosphere and thermosphere.

Explanation:

the stratosphere and the thermosphere

A team of science researchers is trying to decide which type of microscope to purchase for their laboratory. Compared to electron microscopes, a light microscope provides which of these drawbacks or disadvantages?
A. uses electricity
B. specimens cannot be alive
C. lower magnification power
D. more expensive to purchase and operate​

Answers

Answer:

d

Explanation:

The drawback or disadvantage associated with the use of light microscopes over electron microscope is its lower magnification power.

LIGHT MICROSCOPE:

Light microscope is a type of microscope in which photons of light is used to view specimens.

The light microscope is distinct from the electron microscope being that electron microscope uses beam of electrons instead.

One advantage of light microscope is that it can view specimens alive while electron microscope can only view dead specimens.

However, one disadvantage associated with the use of light microscope is that it possesses a lower magnification compared to electron microscopes.

Learn more at: https://brainly.com/question/4442916

DNA is wrapped around
and condensed into chromosomes.

• Genes are used as a set of instructions to produce proteins.

Proteins affect the
and function of organisms.
Chromosome

Answers

Answer:

- DNA is wrapped around nucleosomes and condensed into chromosomes.

- Proteins affect the traits and function of organisms.

Explanation:

Nucleosomes are the basic unit of compaction of DNA. Each nucleosome is composed of ~148 bp double-stranded DNA and an octamer of histone proteins, which include two molecules of each core histone: H2A, H2B, H3 and H4. Subsequently, nucleosomes are packaged into chromatin fibers so they can be densely compacted into chromosomes. On the other hand, proteins are molecules that play important (structural and enzymatic) functions in a cell. These proteins may affect the structure/function of a cell, thereby affecting a certain characteristic/trait to develop.

Select the correct answer. Which statement about natural selection is true? A. Natural selection and evolution are two terms for the same phenomenon. B. Natural selection is an outdated theory to explain how evolution took place. C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce. D. Natural selection is the process by which organisms develop variation in traits, which gives them a better chance of survival.

Answers

Answer:

C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce.

Explanation:

Natural selection is an evolutional process by which species of living organisms with stronger or more beneficial traits have higher chances of survival and reproduction. In other words, it is the process by which organisms adapt and survive.

Organisms in a population are all different in their own ways. And those with characteristics or traits better suited for the environment are more likely to survive than those without. The selection prefers more beneficial traits and not wholly on the superiority of the organism. So, the survival and reproduction chance of an organism depends on the presence of traits beneficial to the environment, which is how nature selects. And in this process, those selected will dominate the population while those rejected will be reduced or even die.

Thus, the correct answer is option C.

1. Identify the 4 major body systems shown below
A.————
B.————
C.————
D.————

Answers

A. Circulatory system
B. Nervous system
C.respiratory system
D. Digestive system
Hope this helped

In humans, free earlobes are dominant to attached earlobes, and a straight thumb is dominant to a hitchhiker's thumb. Cross two people that are heterozygous for both traits. Include a punnett Square

Answers

Answer:

nice pfp

Explanation:

explanation haikyuu

Which of the following describes the process of DNA making copies of itself.
Transcription
Substitution
Translation
Replication

Answers

replication i thinkkkkk
Replication is the answer

What’s the Florida reptile (guess don’t search)

Answers

Answer:

American Alligator

Explanation:

Knowledge

Answer:

ᵗʰᵉ ᵃᵐᵉʳⁱᶜᵃⁿ ᵃˡˡⁱᵍᵃᵗᵒʳɪs ᴛʜᴇ ʀᴇᴘᴛɪʟᴇ.

3. Which of the following statements best explains how the cell membrane 1 point
is selectively permeable? *
The movement of specific substances into and out of the cell is controlled by the cell
membrane
The movement of waste substances into, but not out of the cell is controlled by the
cell membrane
The cell membrane is inflexible and cannot control the movement of substances into
and out of the cell
The cell membrane does not surround the cell so it plays no role in the movement of
substances

Answers

Answer:

The movement of specific substances into and out of the cell is controlled by the cell membrane.

Explanation:

The cell membrane is permeable, so it allows for the passage of substances both into and out of the cell. It is also selective, so only specific substances can enter and exit the cell.

What are examples of Health Informatics workplaces? Check all that apply.

a home office
a hospital cafeteria
a laboratory in a university
a medical clinic’s front office

Answers

Answer:A home office

A medical clinic’s front office

Explanation:

Answer:

Select them all if its "what seems interesting" and Home office and medical front if its What are examples of Health Informatics workplaces? Check all that apply.

Explanation:

Help me please please help me

Answers

Answer:

The first one

Explanation:

A thesis is a statement or theory not a question.

i believe the answer is A
Other Questions
A water pipe has a flow of 2 gallons per minute how many 2 qt could fill it in 1/2 hour? April ought some sports drinks and slices of pizza for her friends. She bought 3 more sports drinks than slices of pizza. If her total was $21.25, how many sports drinks did she purchase? (1 sports drink is $1.75, one pizza slice is $2.75){System of Operations} La oracin que representa un smil es: A. . Cerca del Tajo, en soledad amena, B. . Si no regresas pronto a mi lado, morir desangrado C. Los invisibles tomos del aire D. Eres como el viento tibio de los arenale What river connects the Great Lakes to the Atlantic Ocean? Jeremiah spent $68 for concert tickets. He bought one adult ticket for $18 and several children's tickets for $10 each. Which number line represents the number of children's tickets Jeremiah bought? Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea View the work of art and answer the questions below.The work above is typically known by the name of its location. What is the name of the structure where the work be found? Who created it? PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! What is correct regarding trans fatty acids hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? what is (-10,10) if i dilate it by 1/2 a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years.