When Jack slammed his truck in a tree,his head smashed violently against the dashboard. A ct revealed damage at both the front and back of his brain. What the the best explanation

Answers

Answer 1

The  frontal and temporal lobes were damaged in a closed brain injury.

What is the brain?

The brain is the organ in the body that is in charge of the coordination of every other part of the body. The brain is housed by the skull and is a very important part of all endocrine and nervous coordination in the body.

The CT is an acronym for computed tomography scan. This kind of scan could be used to obtain the details of an organ, in this case, the brain. It can show the extent and type of damage that is done to the brain.

Since slamming the head on the dashboard implies that the brain had to move back and forth under such a high pressure, the  frontal and temporal lobes were damaged. This is called a closed brain injury.

As such, the greatest damage is at the front and back of his brain.

Learn more about brain damage:https://brainly.com/question/5984431

#SPJ1


Related Questions

are the most common forms of sexual harassment?

Answers

Everything ^^ they are the most popular honestly

Which is helping to decrease the workload required for individual offenders?


better prisons

better technology

fewer involved families

fewer reports

Answers

Better prisons bsjsjsiskwbwklwkabw

Answer:

better technology

Explanation:

that's what i put but not sure

What are the basic types of bike tires? (Check all that apply)
All Weather Tires
Snow tires
Clinches
Tubulars

Answers

Answer:

Clinches and tubulars.

Answer:

Snow tires and all weather tires

Explanation:

I got it right on the test

Write about a problem-solving strategy that you’ve used at school or at home and describe the outcome.

Answers

A strategy I have used to calm my self down if a get really mad is to count down from ten, and to take a breath after each number I say. This helps me not feel angry anymore, so there was a positive outcome.

Answer:

Sometimes when I’ve made plans to meet my friends, my parents want me to babysit my little sister because they have plans to go out. I don’t want to cancel on my friends, so I apply the following problem-solving strategies:

Define the problem: I have a schedule conflict. I made plans with my friends, but my parents need me to babysit my sister.

Analyze the problem: My parents have to go out and so do I, but someone has to stay home to watch my little sister. My parents pay my allowance, and thus that someone will have to be me.

Establish goals: I want to be able to meet my friends, but I also do what my parents need me to do—babysit my little sister.

Come up with possible solutions:

Reschedule to meet my friends before my parents have to leave or after they get back home.

Ask my parents if they can reschedule so I can babysit my sister another day and don’t have to change my plans.

Take my sister out with me when I go to meet my friends.

Have my friends come over to my home.

Analyze and implement likely solutions:

My friends can’t meet earlier, but it’s a school night so we can’t meet later or we would be out too late. (Eliminated)

My parents cannot change their plans. (Eliminated)

If I take my sister out with me, I would have to get back home before her bedtime, but I would at least be able to meet my friends. (Likely)

My friends could come over so we could still meet and I could still babysit my sister. (Likely)

Explanation:

PLATO

When riding your bike on a main road you should always follow the rules of the _________.
road
biker’s guide
walkers
town they are riding in

Answers

Answer:

THE ROAD is the answer

Answer:

road is the answer when we are driving on road we should obey traffic rules

The act of making judgmental or opinionated remarks about a person, place or thing to another is:

1. deconstructive criticism
2. racism
3. prejudice
4. criticize

Answers

Answer:

Prejudice

Explanation:

ty guy in comment

Answer:

3.Prejudice

Explanation:

This is where adverse judgement or opinion are formed without knowledge of facts.

The government agency responsible for worker safety is _____.


A. OSHA

B. the FDA

C. the USDA

D. the FBI

Answers

OSHA....Occupational safety and health administration
The answer is A. OSHA

which of the following is not an example of temperature abuse

Answers

Answer: Food is not reheated enough to kill the pathogens.

Explanation:

mark brinlyest

Does anyone know this answer??

Answers

Answer:

Gabe's case did not require the services of a physical treatment

The 3rd one down is the answer

true or false? aging is a normal process that lead to normal changes in body structure and function

Answers

it is true

need more characters to send the answer lol

Renting an apartment after college is a good idea because it can:
A. Establish Credit
B. Establish residency
C. Teach Payment Consistency
D. All of the Above​

Answers

Answer:

All of the above

Explanation:

The answer is D because it helps them become financially responsibke and learn to live on their own,etc.

Complete the following sentence.
The zone of proximal development is a concept that was introduced by____

Answers

My answer is Vygotsky

Answer:

Vygotsky

Explanation:

The Zone of Proximal Development (ZPD) was a key construct in Lev Vygotsky's theory of learning and development.

Please consider giving me brainliest and have a lovely day!

Create a workout that you can complete at home today.

It needs to be at least 10 minutes. It needs to include cardio, strength and core exercises.


Please describe your workout in a paragraph. At least 5 sentences.


plzzzz help

Answers

Answer:

go to yt, search up lily sabri full body 15 min exercise, and copy that down.

ur teacher will be impressed

Exxplanation:

How is understanding Mental Health help you deal with my thoughts, feelings,
actions?
I think this because..

Answers

Answer:

Understanding mental health will help you understand whats going on inside people's heads. They might not tell you but you can look for symptoms. Thats one example of mental health if you know whats going then maybe you can take action before something happens.

Explanation:

How does social media influence our mental and emotional health?

Answers

Answer:

well However, multiple studies have found a strong link between heavy social media and an increased risk for depression, anxiety, loneliness, self-harm, and even suicidal thoughts. Social media may promote negative experiences such as: Inadequacy about your life or appearance.

Explanation:

answer

multiple studies have found a strong link between heavy social media and an increased risk for depression, anxiety, loneliness, self-harm, and even suicidal thoughts. Social media may promote negative experiences such as: Inadequacy about your life or appearance.

Explanation:

Q3: In Placental Mammals the mother provides the embryo with everything it needs. True or False q4: In Metamorphosis, major body changes occur, as animals develop from young organisms into adults. True or False q5: Complete Metamorphic has three stages. True or False q6: Incomplete Metamorphic has four stages. True or False q9: The stage in which a young insect is enclosed in a protective covering is egg. True or False

Answers

Answer:

in placenta mammals the mother provide food through placenta

A girl's first menstruation is called ________ and usually comes ________ in the process of puberty. Group of answer choices

Answers

Answer:

her period, during

Explanation:

write a one-page sexually transmitted diseases

Answers

Answer:

uuh std's

Explanation:

Janet needs to consume enough calories to burn 25-35 per minute. How much food is needed?

Answers

Answer:

5 i think

Explanation:

I think it’s 5 as well

The main goal of a marriage and family therapist is to _____.



improve lifestyles


improve relationships


improve educational levels


improve marriages

Answers

improve relationships

so im like almost 100% sure I have a jammed toe.... so:
1.) how long will it take to heal
2.) I already put ice on it, and its not worth it to go to the doctor, so
3.) what do I do now?

Answers

Answer:

You need to put ice and take profeen and then try not to use it for a bit to maximize the healing

Explanation:

Or Rest. Stop using your toe, lie down, and let your body recover.

Ice. Use ice to numb the pain and reduce swelling. ...

Compression. Wrap your toe, or the entire end of your foot and toes, with an elastic bandage to provide support and keep swelling under control.

Elevation.

3.) What do I need to do now?
Other Questions
Which statement below is NOT a statement within the Cell Theory?A. all cells come from other cellsB. all organisms are composed of cellsC. the cell is the basic unit or organization of organismsD. all cells contain DNA (genetic information) What is wrong with the claim statement: "Everyone should use a cell phone." In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households The Mauryan Empire was called India's Silver Age.True or False A water pipe has a flow of 2 gallons per minute how many 2 qt could fill it in 1/2 hour? La oracin que representa un smil es: A. . Cerca del Tajo, en soledad amena, B. . Si no regresas pronto a mi lado, morir desangrado C. Los invisibles tomos del aire D. Eres como el viento tibio de los arenale What river connects the Great Lakes to the Atlantic Ocean? PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond Please help help me please ASAP I am begging someone please No links or files describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!!