whats three times three

Answers

Answer 1

Answer:

It's 9. There is a couple of ways you can do this. For instance, try dividing 9 to 3 and the answer is 3. Another way, count to 9 and see how many times you used 3. So that answer will be 3.

Explanation:

Answer 2
This would be 9! If you add 3 + 3 + 3 you get 9 as an easier way!

Related Questions

Please please help help please please help me ASAP ASAP please ASAP thank you so much
NO LINKS OR FILES

Answers

Answer:

Need to add a story i believe.

Explanation:

I NEED HELP PLEASEEE I WILL MARK BRAINLEIST

Answers

D overflowing rivers

Name a way that each branch of government can get around the formal process for amending the Constitution. Why are the three branches able to do this?

Answers

Answer:

Explanation:

The branches must both cooperate and compete to enact policy. ... The central government under the Articles lacked a strong executive and a method for resolving ... three branches—legislative, executive, and judicial—so that each branch had to cooperate ... Accordingly, each branch of government has unique powers.

Glorieta pass _______

a: is a rugged, difficult place.
b: was located on top of a mesa
c: was a toll road
d: is located in four corners

Answers

A. It’s a rugged, difficult place
Option A-is rugged, difficult place is correct

The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:
We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?

The purpose of this excerpt is..

A. to describe the physical examination experienced by an immigrant family.
B. to explain the day-to-day schedule experienced by an immigrant family.
C. to describe the fond memories experienced by an immigrant family.
D. to explain the feelings of worry experienced by an immigrant family.

Answers

Answer:

Option D, The purpose of this excerpt is to explain the feelings of worry experienced by an immigrant family.

Explanation:

The excerpt clearly indicates the worry of an immigrant family that is concerned about the physical examination. The concern is majorly regarding the rejection of even one member of the family as in such condition it will be difficult for the rest of the family to decide what to do.

Hence, option D is correct

the American genocide is an example of
a. diplomacy
b. a government using war as an excuse to commit atrocities on its own citizens
c. communist revolution
d. self determination

Answers

Answer:

B. A government using war as an excuse to commit atrocities on its own citizens.

Explanation:

I believe its this, but do you mean or armenian, because that might change the answer.

If the Supreme court states that a law is constitutional, can the same kind of law be written by other states?

Answers

Answer:

Yes, it works sort of like a mom and a parent. If the parent says its ok that she can eat in her room, then by that logic, the child can too eat in his room because the authority did it first.

Hope this helps!

(also note, i'm no expert on law and i'm also doing an exam, soo...yeah)

What is one service the Freedmen's Bureau provided for African Americans?
The agency provided funds to pay poll taxes.
The agency set up courts to settle land disputes.
The agency taught them how to cultivate crops.
The agency found employment in Northern cities.

Answers

Answer:

b

Explanation:

got right on edge

The agency set up courts to settle land disputes: is one service the Freedmen's Bureau provided for African Americans. Thus, option B is the correct option.

What were Freedmen's Bureau Acts of 1865 and 1866?

On March 3, 1865, Congress approved "An Act to Establish a Bureau for the Relief of Freedmen and Refugees" to give displaced Southerners, including newly liberated African Americans, food, housing, clothes, medical care, and land. The Freedmen's Bureau was tasked with running "during the present war of rebellion, and for one year thereafter," in addition to establishing schools, monitoring employment agreements between freedmen and employers, and overseeing seized or abandoned properties.

In the conflict between President Andrew Johnson and the radical Republicans in Congress over Reconstruction and the role of the federal government in integrating four million newly emancipated African Americans into the political life of the country, the fight to establish the Freedmen's Bureau and then to extend the legislation one year later played a significant role.

Learn more about Freedmen's Bureau Acts here:

https://brainly.com/question/14117703

#SPJ2

Can someone help pls

Answers

Answer: to claim new territory.

Explanation:

Examine Item A in your test documents. Which municipal area most likely has
the least influence on elections due to the reapportionment shown?
A. Gardiner
B. Woodstock
C. Shawangunk
D. Rochester

Answers

Answer: Shawangunk

Explanation:

a pex

Due to the reapportionment, Shawangunk's municipal area probably has the least impact on elections.

What is Municipal election?Municipal election means an election or primary, either regular or special, in cities, villages, and incorporated towns."Municipality" means any such city, village or incorporated town.Municipal election means a general election, first election, by-election and a vote on a bylaw or question.

Town of Shawangunk--The Town of Shawangunk is led by a supervisor and a board of four council members. The current supervisor is John Valk, Jr., in office since 1998.The Town of Shawangunk (Town) is located in Ulster County and has a District that provides sewer services to the Hamlet of Wallkill and two correctional facilities: the Wallkill Correctional Facility and Shawangunk Correctional Facility which are operated by DOCCS.The Town is governed by a five-member elected Town Board (Board) composed of the Town Supervisor (Supervisor) and four Town Council members.

Learn more about Municipal Election on:

brainly.com/question/969142

#SPJ2

Worth 50 points and will give brainliest!!!!!

What connection to America’s government does the Magna Carta have?

Answers

Answer:

a legacy that captured American distrust of concentrated political power.

Explanation:

Answer:

However, its influence was shaped by what eighteenth-century Americans believed Magna Carta to signify. Magna Carta was widely held to be the people's reassertion of rights against an oppressive ruler, a legacy that captured American dis trust of concentrated political power.

Explanation:

i honestly goo,gled it

if u want put brainliest though i don't deserve it :(

Which climate zone has mild temperatures, hot/dry summers and cool winters and covers 5% of the land

Savanna (Tropical Wet and Dry)
Tropical Wet (rainforest)
Desert
Mediterranean

Answers

Answer:

Tropical weather is a good place for a new

How did Dollar Diplomacy help prevent costly wars?
A. It spread American influence by buying countries.
O B. It spread American influence through business.
O C. It spread American influence by means of the gold standard.
D. It spread American influence through missionary activity.

Answers

Answer: B. It spread American influence through business.

Explanation:APX

It spread American influence through business did Dollar Diplomacy to help prevent costly wars. Hence, option B is correct.

What is Dollar Diplomacy?

Dollar Diplomacy is an international strategy developed by U.S. President William Howard Taft and his secretary of state, Philander C. Knox, to maintain a region's financial stability while defending and advancing American business and financial interests there.

The practice of a government promoting and defending its private individuals', firms', etc.'s business interests abroad by means of its economic influence or strength. A nation's use of economic might to advance its foreign policy objectives.

Dollar diplomacy was developed to ensure American financial prosperity and assert the country's dominance over other countries. As part of its foreign strategy known as "dollar diplomacy," the United States gave money to other nations in exchange.

Thus, option B is correct.

For more information about Dollar Diplomacy, click here

https://brainly.com/question/10688724

#SPJ5

6. What year did South Africa first gain self-rule?
1961
1932
1910
7. Why was the African National Congress formed?
To fight for equal rights
To fight for separation of church and state
To help Africa and China join forces

Answers

Answer: 1961, to fight for equal rights

Explanation:

The African National Congress fought towards uniting all ethnicities, groups of people, and races together. They fought for equal voting rights, as well as other rights that improved equality between people.

Which advancement most helped increase trade during the postclassical era? O A. More complex religions O B. More delicate pottery O C. More accurate compasses D. More sophisticated calligraphy​

Answers

Answer:

More accurate compasses

Answer:

More accurate compasses

Explanation:

How did the Columbian exchange lead to the development of capitalism

Answers

Answer:

The Columbian Exchange caused population growth in Europe by bringing new crops from the Americas and started Europe's economic shift towards capitalism. Colonization disrupted ecosytems, bringing in new organisms like pigs, while completely eliminating others like beavers.

Explanation:

Hope it helps you!

just follow me for more!

I'm willing to help!

Answer:

Explanation:

The Columbian Exchange caused population growth in Europe by bringing new crops from the Americas and started Europe's economic shift towards capitalism.

Helped by the ONE & ONLY #QUEEN aka #DRIPPQUEENMO

Hoped this helped!! :)

This former slave had lived in a free territory with his owner. When his owner
moved back to a slave state he had passed away. Now this former slave is fighting
for his freedom.
1.Homer Plessy
2.Frederick Douglas
3.Dred Scott
4.John Brown

Answers

Answer:

i think it is homer dred scott

Explanation:

i think but may not be right so sorry if wrong

One effect of road, air, and rail transportation in Georgia is that they

Answers

Georgia's four transportation systems (air, water, rail, & highway) have been instrumental in the economic growth and development of the state. ... The four transportation systems work together, transferring cargo among various modes of transport to provide Georgians with goods produced in the U.S. and around the world.

Georgia's economy depends on the interstate highway system. Highways in Georgia enable quick and dependable shipments to the rest of the country and the rest of the world.

What is the impact of transportation on the environment?

Transportation systems are a factor in both deteriorating air quality and a changing climate because of the emissions produced by the combustion of fossil fuels. Additionally, transportation contributes to air and water pollution and has a variety of direct and indirect effects on ecosystems.

The state's economy depends on how the four transportation systems work together. Being the "transportation hub" of the southeast, Georgia efficiently and quickly moves people and goods to domestic and international markets by air, land, sea, and rail, which helps businesses save time and money.

Learn more about transportation here:

https://brainly.com/question/12133248

#SPJ2

Taxes upon earnings are____taxes.

income
severance
excise
sales

Answers

Answer:

income taxes

Explanation:

This kind of taxes are levied on an individual's wages

What was covey supposed to do with Douglass?

Answers

Answer:

He was suppose to get a punishment

Explanation:

Covey orders him to take off his clothes and receive punishment.When Douglass does not respond, Covey rushes at him, tears his clothing off, and whips him repeatedly. Covey continues to whip Douglass almost weekly, usually as punishment for Douglass's supposed “awkwardness.”

Answered by the ONE & ONLY #QUEEN  aka #DRIPPQUEENMO

Hoped this helped!

What were some of Hideki Tojo's actions taken or policies put in place that would be classified as totalitarian?

Answers

Supporter of Nazi Germany.He advocated pre-emptive air strikes on both China and the Soviet UnionRacist supremacy of Yamato raceWomen had few rights opposition to western ideasManchurian Incident - invasion of Chinese Manchuria (real start of WW2)

Will give brainliest:

A classmate asked me to send a pic of my Spanish assignment. I’m a nice person but how do I tell her no nicely? I don’t want to face consequences of plagiarism if she steals the answers. What do I do

Answers

Answer:

Just explain that you dont want to as you don't  want any trouble for either of you.You are under no obligation to give her your answers.

Explanation:

Just be honest that’s all it takes you don’t need to explain honesty goes a long way

Desertification can lead to starvation, malnutrition and poverty but the use of crop rotation and tree belts can help stop it
True
False

Answers

Answer:

True

Explanation:

Desertification is a situation where a large numbers of trees are felled without planting replacements. This practise is very common and is unhealthy to the environment.

Therefore, desertification can lead to starvation, malnutrition and poverty but the use of crop rotation and tree belts can help stop it. This is true.

Which of the following groups of people would support democracy for all and drastic changes within the government?
1 conservative?
2 Liberals
3 radicals
4 parliamentarians

Answers

Answer:

What are the 5 democratic ideals?

Liberty and equality.

Explanation:

The group of people who would support democracy for all and drastic changes within the government are radicals. Therefore, option (3) is correct.

What is democracy?

Democracy is a system of government in which power is vested in the people, either directly or through elected representatives. In a democratic system, the people have the right to participate in the decision-making process of the government.

Some of the key characteristics of a democratic system include free and fair elections, protection of individual rights and freedoms, separation of powers between the different branches of government, and a system of checks and balances to prevent the abuse of power.

The radicals were the group of people who would support democracy for all and drastic changes within the government. Therefore, option (3) is correct.

Learn more about democracy here:

https://brainly.com/question/13158670

#SPJ2

how was the Civil Rights Movement different from the movement to free India​

Answers

Howard Thurman, a mentor to Martin Luther King, first met Gandhi during a visit to India in 1936. He came to understand nonviolence as ..

How was the first World War the result of changes that
occurred in the long nineteenth century?

Answers

Answer:

The causes of these revolutions were connected through new intellectual and political ideas, as well as economic issues. ... Enlightenment ideals 1start superscript, 1, end superscript of freedom and equality strongly influenced the revolutionary age as they challenged the old order of life.

Explanation:

How did conflict develop between Spanish settlers and Native Americans in the Southwest?

Answers

Answer:Conflict developed between Spanish settlers and Native Americans in the Southwest in that the Native Americans began to fight over buffalo herds.

Explanation:Spanish leaders formed alliances with some of the Indian tribes and provided them with tools, crops, livestock, and arms. The new materials available to these tribes gave them superior weaponry over their enemies. As Indians acquired horses, they became more mobile.

pls help quick im stuck

Answers

The answer to the question is A.
I think it’s supposed to be A

Select the correct answer. What does "equal protection under the law" mean? A. Everyone is entitled to the same economic opportunities in a state, regardless of ability. B. Everyone has the right to participate in all legal activities in a state, regardless of cost. C. Everyone who breaks a law should receive punishment based on their race or class. D. Everyone has the same remedies if they think they have been unlawfully discriminated against.

Answers

Answer:

D

Explanation:

summarize the treaties that led to the end of the cold war

Answers

Answer:U.S.-Soviet relations improved considerably during the middle 1980s. At a dramatic summit meeting in Reykjavik, Iceland, in October 1986, Gorbachev proposed a 50-percent reduction in the nuclear arsenals of each side, and for a time it seemed as though a historic agreement would be reached. The summit ended in failure, owing to differences over SDI. However, on December 8, 1987, the Intermediate Nuclear Forces (INF) Treaty was signed in Washington, eliminating an entire class of nuclear weapons. The INF Treaty was the first arms-control pact to require an actual reduction in nuclear arsenals rather than merely restricting their proliferation.

As the decade came to an end, much of the Eastern Bloc began to crumble. The Hungarian government took down the barbed wire on its border with Austria and the West. The Soviet Union did nothing in response. Although travel was still not completely free, the Iron Curtain was starting to unravel. On November 10, 1989, one of the most famous symbols of the Cold War came down: the Berlin Wall. By the end of the year, leaders of every Eastern European nation except Bulgaria had been ousted by popular uprisings.

By mid-1990, many of the Soviet republics had declared their independence. Turmoil in the Soviet Union continued, as there were several attempts at overthrowing Gorbachev. On December 8, 1991, the Soviet Union ceased to exist. Boris Yeltsin, president of the Russian Republic, formed the Commonwealth of Independent States (C.I.S.). After 45 years, the Cold War was over.

Explanation:

Other Questions
Write the relationship between cells, tissue and organs in human body.(plzzzzz answer correctly) At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?The purpose of this excerpt is..A. to describe the physical examination experienced by an immigrant family.B. to explain the day-to-day schedule experienced by an immigrant family.C. to describe the fond memories experienced by an immigrant family.D. to explain the feelings of worry experienced by an immigrant family. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Help!!! I do not seem to understand this problem well. Why would an investor want to choose a certificate of deposit over a corporate bond Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver I will mark Brainliest for frist answer This Question: 1 pt20 of 20This QuthThe pH of a fruit juice is 2.9. Find the hydronium ion concentration, [H30 * ), of the juice. Use the formula pH = -log[H30*]The hydronium ion concentration [H30 + ] is approximately moles per liter.(Use scientific notation. Use the multiplication symbol in the math palette as needed. Round to the nearest tenth as needed.) A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size When riding your bike on a main road you should always follow the rules of the _________.roadbikers guidewalkerstown they are riding in