What is the quotient? 2y2-6y-20/4y+12

What Is The Quotient? 2y2-6y-20/4y+12

Answers

Answer 1

Answer:

last 4rd

Step-by-step explanation:


Related Questions

thomas has 12 more marbles than twice the number of marbles Andrew has.
Andrew has x marbles. which expression represents how many marbles thomas has?
A. x + 2 + 12
B.x+12(2)
C.2x+12
D.2(x+12)​

Answers

Answer:

A.

x + 2 + 12

Step-by-step explanation:

Thomas (t) = Andrew (x) * 2 + 12

Find the value of x.

Answers

answer: x=66
explanation: x+(x-20)+(2x+10)+(x+40)=360
5x+30=360
5x=330
x=66

look at pic 10 pts will mark brainilest

Answers

Answer:

its a right angle and the area of it is 24

Step-by-step explanation:

write a mathematical equation and calculate the area of the irregular polygon

Answers

3)5/6)=x 36-508-7392

Can you figure out the missing number​

Answers

Answer:

probably 6 thats one of the missing ones

Factor the expression (x+4)^2-4y^5(x+4)+4y^10

Answers

if you factor this,
it is (x+4-2y^5)^2

PLZ ANSWER QUIKCLY
Which expression is equivalent to -12(3x-3/4)

-36x-8

-36x + 8

-36x-9

-36x +9

Answers

Answer:

Last one, -36x+9.

Explanation: You need to multiply negative times positive which is negative. But look at the last one -12×-3/4 equals positive 36/4 which equals 9.

Help for 20 points please

Answers

I think that the answers to this question is going to be B

Answer:

The Answer is 12 - 15= 129

Step-by-step explanation:

x2−15=129

Step 1: Add 15 to both sides.

x2−15+15=129+15

x2=144

Step 2: Take square root.

x=±√144

x=12

the measure of an angle and its complements are 13x and 17x write an equation then solve​

Answers

Step-by-step explanation:

Aal kimoya iyah I love 18

A customer at the store wanted to buy a different watch that was listed at $88 but had a 15% discount. Then the customer had to pay a sales tax of 5% on the discounted price. How much did the customer pay for the watch? *

Answers

Step-by-step explanation:

88 X 0,15 =....

... X 1.05 = answer

giving brainliest!! *easy*

Answers

Answer:

370 square millimeters

Step-by-step explanation:

2x9x5=90

2x10x5=100

2x10x9=180

90+100+180=370 square millimeters

Answer

450mm^3

Step-by-step explanation:

the picture has the workings

A=l×w×h

A=10mm×9mm×5mm

A=450mm^3

plzzzz help meeeeeeeeeeee

Answers

It is the 2nd one you’re welcome

Please I beg of you answer this question please answer this correctly no links no trolls pleaseeee

Answers

Answer:

Step-by-step explanation:

pi r^2 for area

pi 35^2

pi1225= about 3848.45

2pi r for circumference

2pi35

pi70= about 219.9

ANSWER THE QUESTION FOR BRAINLIEST

Answers

Non linear means not a straight line so answer C or the third answer.

Answer:

not a straight line

Step-by-step explanation:

Linear has the word "line" in it. A linear relation has a graph shaped like a straight line.

Nonlinear means "not like a straight line".

Answer: not a straight line

at a football game, every person is either a fan of the home team or of the visiting team. omar observes that the ratio of fans of the home team to fans of the visiting team is 7:2. omar states that the total number of fans at the game must be an odd number because 7 + 2 = 9 and 9 is an odd number.

Determine a number of fans of the home team and a number of fans of the visiting team that show omar statement is false.

the first question is, enter a number of fans of the home team that would show Omar's statement is false.

the second question, enter a number of fans of the visiting team that would show omar statement is false.



pls I need help!!!!!!​

Answers

14 fans for the home team and 4 for the away will still hold the ratio and prove Omar’s statement false.

What is an equation of the line that passes through the point (-5,-2) and is
parallel to the line x - y = 5?

Answers

Answer:

[tex]y=x+3[/tex]

Step-by-step explanation:

What we need to know

Linear equations are typically organized in slope-intercept form: [tex]y=mx+b[/tex] where m is the slope of the line and b is the y-intercept (the value of y when the line crosses the y-axis)Parallel lines have the same slope

1) Rewrite the equation x - y = 5 into slope-intercept form and identify the slope

[tex]x - y = 5[/tex]

Subtract both sides by x

[tex]x - y -x= -x+5\\-y= -x+5[/tex]

Divide both sides by -1

[tex]y= x-5[/tex]

Now, we can tell clearly that the slope (m) of this line is 1. Therefore, a line parallel to this would also have a slope of 1.

Plugging 1 as m into [tex]y=mx+b[/tex], we get:

[tex]y=x+b[/tex]

2) Find the y-intercept (b) of the line parallel to [tex]y= x-5[/tex] and find the final equation

[tex]y=x+b[/tex]

Plug in the given point (-5,-2)

[tex]-2=-5+b[/tex]

Add 5 to both sides

[tex]-2+5=-5+b+5\\3=b[/tex]

Therefore, the y-intercept of this line is 3. Now, plugging this back into our original equation, we get:

[tex]y=x+b\\y=x+3[/tex]

I hope this helps!

Raymond bought wrapping paper that cost
$0.04 per square inch. How much did it cost to
wrap this box.

Answers

Answer: $46.08

Step-by-step explanation:

Find the surface Area of the box

the bases are 12*12= 144 times 2 bases 144*2= 288

The area of each side is 12*18=216 times 4 sides 216*4=864

add the totals together to find the total surface area 288+864=1152

total surface area is 1152 inches. Multiply by the cost per square inch

1152*.04= 46.08

ANSWER ASAP PLS

The circular opening of a tunnel has a circumference of 36 meters. Which equation can be used to find d, the
diameter of the tunnel opening in meters?

Answers

D = circumference divided by Pi

D = 36 divided by 3.14

D = 11.5

Determine what type of solution the following equation has: 3(x-1)+5=3x+2

- No solution
- One solution
-Infinitely Many solution

Answers

If I’m not wrong it’s one solution because the sum of 3(x-1)+5=3x+2 is 0

Hope this helps!

What is the equation of a line with a y-intercept at (0, 2) and a slope of 3?
a. y = 2x + 3
C. y = 3x + 2
b. y = 3x - 2
d. y = -2x + 3

Answers

Answer:

answer is C

the slope is 3 and the intercept is (0,2) which is 2

5 rubber stamps cost $9.70.
Which equation would help determine the cost of 11 rubber stamps?
A: x/11 = 5/9.70
B: 11\$9.70 = x/5
C: 5/11 = x/9.70
D: 11/5 = 9.70/x
E: None of the above

Answers

E None of the above

Annabelle’s bicycle has a wheel radius of 13 inches. She places a sticker on the wheel so that its minimum height above the ground is 0.5 inches. When she rides her bicycle, the wheel completes 90 revolutions every minute. The sticker begins at its minimum height above the ground. Which equation models the height in inches of the sticker after x minutes? y = 0.5 sine (180 pi x) + 13 y = 12.5 sine (180 pi x) + 13 y = 0.5 sine (180 pi x minus StartFraction pi Over 2 EndFraction) + 13 y = 12.5 sine (180 pi x minus StartFraction pi over 2 EndFraction) + 13

Answers

Answer:

[tex]y=12.5 sin(180\pi x-\frac{\pi}{2})+13[/tex]

Step-by-step explanation:

In order to solve this we can start by drawing a sketch of the problem (see attached picture)

So fist, let's take the general form of a sinusoidal movement:

[tex]y=Asin(\omega x+\phi)+b[/tex]

where:

A= amplitude

[tex]\omega[/tex]= angular frequency

x= time

[tex]\phi[/tex] = horizontal shift

b= vertical shift.

In this case, the amplitude will be the maximum distance between the center of the wheel and the highest or lowest point of the trajectory, in this case:

A= 13in - 0.5in =12.5 in

The angular frequency is how many radians the wheel will turn in a minute, so we get:

[tex]\omega=\frac{90 rev}{min}*\frac{2\pi rad}{1 rev}[/tex]

[tex]\omega=180\pi rad/min[/tex]

Generally, the sin function will start at the center of the circular movement. In this case, since it starts on the lowest point, we can say that the graph moves right by [tex]\frac{\pi}{2} rad[/tex], so in this case:

[tex]\phi=-\frac{\pi}{2}[/tex]

and finally, the vertical shift is the distance between the center of the circular movement and the ground so in this case:

b=13in

so when putting it all together we get our equation to be:

 [tex]y=12.5 sin(180\pi x-\frac{\pi}{2})+13[/tex]


The functions f and g are defined as follows.
g(x) = -2x3-5
f(x) = - 4x + 2
Find f (6) and g(-3)
Simplify your answers as much as possible.

Answers

Answer:

f(6) = -22, and g(-3) = 49

Step-by-step explanation:

f(x) = -4x + 2

f(6) = -4(6) + 2

f(6) = -24 + 2

f(6) = -22

I assume the 3 in g(x) = -2x3 -5 is cubed

g(-3) = -2(-3)^3 - 5

g(-3) = -2(-27) - 5

g(-3) = 54 - 5

g(-3) = 49

=[tex]\frac{mv^{2} }{2}[/tex] ; Solve for v.

Answers

Answer:

[tex]v=\sqrt{\frac{2E}{m} }[/tex]

Step-by-step explanation:

[tex]E=\frac{mv^2}{2}[/tex]

[tex]2E=mv^2}[/tex]

[tex]v^2=\frac{2E}{m}[/tex]

[tex]v=\sqrt{\frac{2E}{m} }[/tex]

a) A car is purchased for $30000 and is depreciating at a rate of 12% per
year. Write an equation to represent this situation.
b) What is the car worth in 10 years?
c) How many years does it take for the car to be worth $1000

Answers

Answer: 187.5 gallons of gas

Step-by-step explanation:

He travels 30000 miles per year, and each gallon lets him travel 16 miles. Divide 30000 by 16 to get the amount of gas he uses in a year, which amounts to 187.5 gallons of gas.

The volume of this rectangular prism is 53.72 cubic centimeters . what is the value of y?

Answers

Answer:

y = 1.7 cm

Step-by-step explanation:

V= lwh

w = [tex]\frac{V}{lh}[/tex] = [tex]\frac{53.72 cubic centimeters}{4cm(7.9cm)}[/tex] = 1.7 cm

find the slope of each line​

Answers

Answer:

(1,1) and (2,-4)

Step-by-step explanation:

i supposed each line is 1,2,3,4,5 because it is not given the graph numbers but I hope it could help

12) A large box of crackers weighs 20 oz. If James needs 3 pounds of crackers for a
party, how many boxes of crackers should he buy?

Answers

Answer: about 3 boxes would be 3.50 lbs so idrk

Step-by-step explanation:

Which graph represents a direct variation?

Answers

I don't know all of them I guess since I can't see the graphs

Answer:

The graph of the direct variation equation is a straight line through the origin.

Step-by-step explanation:

What is 74 in standard form? O A. 11 OB. 28 Oc. C. 2, 401 O O D. 16,384​

Answers

Answer:

oc2

Step-by-step explanation:

because

Other Questions
At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? can somebody help please 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?The purpose of this excerpt is..A. to describe the physical examination experienced by an immigrant family.B. to explain the day-to-day schedule experienced by an immigrant family.C. to describe the fond memories experienced by an immigrant family.D. to explain the feelings of worry experienced by an immigrant family. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris Puteti sa ma ajutati va rog 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Help!!! I do not seem to understand this problem well. Why would an investor want to choose a certificate of deposit over a corporate bond describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver I will mark Brainliest for frist answer