What is the purpose of principle of checks and balances in the constitution?

Answers

Answer 1

Answer:

The main purpose of the system of checks and balances in the United States Constitution is to ensure that no one branch of the American government becomes more powerful than the others.

Explanation:

Answer 2

Answer:

Checks and balances, principle of government under which separate branches are empowered to prevent actions by other branches and are induced to share power. Checks and balances are applied primarily in constitutional governments.

Explanation:


Related Questions

One effect of road, air, and rail transportation in Georgia is that they

Answers

Georgia's four transportation systems (air, water, rail, & highway) have been instrumental in the economic growth and development of the state. ... The four transportation systems work together, transferring cargo among various modes of transport to provide Georgians with goods produced in the U.S. and around the world.

Georgia's economy depends on the interstate highway system. Highways in Georgia enable quick and dependable shipments to the rest of the country and the rest of the world.

What is the impact of transportation on the environment?

Transportation systems are a factor in both deteriorating air quality and a changing climate because of the emissions produced by the combustion of fossil fuels. Additionally, transportation contributes to air and water pollution and has a variety of direct and indirect effects on ecosystems.

The state's economy depends on how the four transportation systems work together. Being the "transportation hub" of the southeast, Georgia efficiently and quickly moves people and goods to domestic and international markets by air, land, sea, and rail, which helps businesses save time and money.

Learn more about transportation here:

https://brainly.com/question/12133248

#SPJ2

This former slave had lived in a free territory with his owner. When his owner
moved back to a slave state he had passed away. Now this former slave is fighting
for his freedom.
1.Homer Plessy
2.Frederick Douglas
3.Dred Scott
4.John Brown

Answers

Answer:

i think it is homer dred scott

Explanation:

i think but may not be right so sorry if wrong

What is one service the Freedmen's Bureau provided for African Americans?
The agency provided funds to pay poll taxes.
The agency set up courts to settle land disputes.
The agency taught them how to cultivate crops.
The agency found employment in Northern cities.

Answers

Answer:

b

Explanation:

got right on edge

The agency set up courts to settle land disputes: is one service the Freedmen's Bureau provided for African Americans. Thus, option B is the correct option.

What were Freedmen's Bureau Acts of 1865 and 1866?

On March 3, 1865, Congress approved "An Act to Establish a Bureau for the Relief of Freedmen and Refugees" to give displaced Southerners, including newly liberated African Americans, food, housing, clothes, medical care, and land. The Freedmen's Bureau was tasked with running "during the present war of rebellion, and for one year thereafter," in addition to establishing schools, monitoring employment agreements between freedmen and employers, and overseeing seized or abandoned properties.

In the conflict between President Andrew Johnson and the radical Republicans in Congress over Reconstruction and the role of the federal government in integrating four million newly emancipated African Americans into the political life of the country, the fight to establish the Freedmen's Bureau and then to extend the legislation one year later played a significant role.

Learn more about Freedmen's Bureau Acts here:

https://brainly.com/question/14117703

#SPJ2

True or false: Paul revere was poor prior to the American revolution

Answers

Answer:

true

Explanation:

Revere died of natural causes on May 10, 1818 at the age of 83, leaving five children, several grandchildren, and many great-grandchildren. The son of an immigrant artisan, not born to wealth or inheritance, Revere died a modestly well-to-do businessman and a popular local figure of some note.

If the Supreme court states that a law is constitutional, can the same kind of law be written by other states?

Answers

Answer:

Yes, it works sort of like a mom and a parent. If the parent says its ok that she can eat in her room, then by that logic, the child can too eat in his room because the authority did it first.

Hope this helps!

(also note, i'm no expert on law and i'm also doing an exam, soo...yeah)

PLEASE HELP BRAINLEST AND 50 POINTS!!!!!!!!!!
In one or two paragraphs, explain why women struggled for so long to gain the right to vote in the United States. Make sure your answer includes a common social belief about women in the 1800s, an issue the women's rights movement had to overcome, and a legal barrier activists faced as they fought for voting rights.

Answers

Woman struggled because they were weak too ppl eyes

Which of the following terms was NOT one of the terms of the Treaty of Versailles?
(1 Point)
A. "War Guilt Clause"

B. War Reparations

C. Breakup of the German nation

D. Territorial loss

Answers

The answer is break-up of the German nation. C

True or False
The most powerful empire between the 1500s and 1600s was the Ottoman Empire.
O True
False

Answers

Answer:

I'm pretty sure it's False:)

Explanation:

The British empire was the most powerful at that time

What was the role of boys and men? Today, many people would strongly disagree with the Nazis' decision to make gender the basis for extreme differences in schooling. What stereotypes about girls and boys did the Nazi program rely on?

Answers

Answer:

Nazi leaders inspire young people in different ways.

Explanation:

After the Nazis came to power in 1933, they passed new laws related to public education. Nationalist and racial ideologies were some of the thing taught in schools. The regime made a special effort to reach young people. All youths between the ages of ten and eighteen were required to join the Hitler Youth. The Nazi schools known for their strict rules and no place for weaklings. The Nazi draws a difference between girls and boys, indicating girls for their naturally weak, and boys for natural strength. The Nazi program had stereotypical ideas about girls and boys as they believed girls to be breeders and boys to become soldiers. Co-educational schools were prohibited.

Which of the following terms BEST summarizes US foreign policy from 1939 until the present?
A.
expansionism
B.
isolationism
C.
internationalism
D.
imperialism


Please select the best answer from the choices provided

A
B
C
D

Answers

D. Imperialism
Is the correct answer

Please real answers. Marking brainliest.

How did Gerald Ford become president of the United States?

A. He was elected president in a special election.
B. He was vice president when the president resigned.
C. He was elected president following an election campaign.
D. He was appointed by Congress after the president was impeached.

Answers

The answer is d he was appointed by congress after the president was impeached

Answer:

B - He was vice president when the president resigned.

Worth 50 points and will give brainliest!!!!!

What connection to America’s government does the Magna Carta have?

Answers

Answer:

a legacy that captured American distrust of concentrated political power.

Explanation:

Answer:

However, its influence was shaped by what eighteenth-century Americans believed Magna Carta to signify. Magna Carta was widely held to be the people's reassertion of rights against an oppressive ruler, a legacy that captured American dis trust of concentrated political power.

Explanation:

i honestly goo,gled it

if u want put brainliest though i don't deserve it :(

tell me if you can’t see the photo! photo is above the picture!

Answers

Mount Olympus is the tallest mountain in Greece

How did Dollar Diplomacy help prevent costly wars?
A. It spread American influence by buying countries.
O B. It spread American influence through business.
O C. It spread American influence by means of the gold standard.
D. It spread American influence through missionary activity.

Answers

Answer: B. It spread American influence through business.

Explanation:APX

It spread American influence through business did Dollar Diplomacy to help prevent costly wars. Hence, option B is correct.

What is Dollar Diplomacy?

Dollar Diplomacy is an international strategy developed by U.S. President William Howard Taft and his secretary of state, Philander C. Knox, to maintain a region's financial stability while defending and advancing American business and financial interests there.

The practice of a government promoting and defending its private individuals', firms', etc.'s business interests abroad by means of its economic influence or strength. A nation's use of economic might to advance its foreign policy objectives.

Dollar diplomacy was developed to ensure American financial prosperity and assert the country's dominance over other countries. As part of its foreign strategy known as "dollar diplomacy," the United States gave money to other nations in exchange.

Thus, option B is correct.

For more information about Dollar Diplomacy, click here

https://brainly.com/question/10688724

#SPJ5

katangian ni Gilgamesh kung bakit siya itinuring na isang bayani sa Epiko.

Answers

Answer:

it means "Gilgamesh’s characteristic is why he is considered a hero in the Epic." or, nangangahulugang "ang katangian ni Gilgamesh ay kung bakit siya ay itinuturing na isang bayani sa Epiko."

Explanation:

Which statements about Saddam Hussein are accurate? Check all that apply.

1-He was a dictator.
2-He was president of Iran.
3-He was overthrown.
4-He invaded Iraq in 1980.
5-He committed war crimes.

Answers

Saddam Hussein was a dictator, He was president of Iran, He invaded Iraq in 1980, He was overthrown And He committed war crimes. Both populations were subjected to full-scale massacres and other grave human rights crimes by his forces.

How was Saddam punished?

Saddam Hussein was hanged to death on  Eid al-Adha in 2006 for pulling major crimes against the humanity.

It's a day that will live on in the imaginations of Iraqis who saw their terrible dictator walk towards the gallows and have a rope tightened around his neck.

Thus, option A, B, C, D and E are correct.

For more details about Saddam Hussein , click here:

https://brainly.com/question/11467252

#SPJ2

Answer:

A,B,C,D,E on edge

Explanation:

The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:
We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?

The purpose of this excerpt is..

A. to describe the physical examination experienced by an immigrant family.
B. to explain the day-to-day schedule experienced by an immigrant family.
C. to describe the fond memories experienced by an immigrant family.
D. to explain the feelings of worry experienced by an immigrant family.

Answers

Answer:

Option D, The purpose of this excerpt is to explain the feelings of worry experienced by an immigrant family.

Explanation:

The excerpt clearly indicates the worry of an immigrant family that is concerned about the physical examination. The concern is majorly regarding the rejection of even one member of the family as in such condition it will be difficult for the rest of the family to decide what to do.

Hence, option D is correct

describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!!

Answers

Answer: After Washington became a state it created its state militia in 1890. ... In 1940, more than a year before the U.S. entered World War II, the Washington State Guard was reestablished with an Infantry Brigade and two Regiments. During WWII the WSG was used to guard vital installations and to patrol the coast lines.

Explanation:

How did the Iranian hostage crisis affect American opinion?
A. Americans suspected that the shah was pro-Soviet.
B. Americans were angry at Carter.
C. Americans supported the Ayatollah Khomeini.
D. Americans suspected the embassy staff were spies.

Answers

Answer:

B!

Explanation:

Jimmy Carter failed to save the hostages. leading Americans to be very upset and disappointed.

The Iranian hostage crisis affects the American opinion as Americans were angry at the carter.

What do you mean by opinion?

An opinion refers to any view or judgment formed about something.

The Iranian hostage crisis affect the American opinion as Americans were angry at Jim carter.

Therefore, B is the correct option.

Learn more about opinion here:

https://brainly.com/question/8530142

#SPJ2

PLEASE HELP ASAP I'M BEING TIMED!!!!!!!!!!!!!!!!!

During the 1800s, Egypt, India, and China became either economically and/or politically exploited by which country?

A. France
B. Britain
C. United States
D. Germany

Answers

Answer:

b

Explanation:

Under the Sun King, intendants
a. collected taxes.
b. recruited soldiers.
C.carried out the king's policies.
d. all of the above.

Answers

I think the answer is d. All of the above

What is Grant's plan for attacking Vicksburg?

Answers

Answer: An extended siege.

Explanation:

General Ulysses S. Grant had first tried to take Vicksburg in 1862 but failed and had to try again because Vicksburg was a very important town that sat on the Mississippi river and would give the Union control of the river if it fell.

After Grant defeated General John C. Pemberton close to Vicksburg, Pemberton retreated to Vicksburg where he was trapped by Grant who fended off attacks to liberate the city and constantly bombarded it from Union positions.

Ordering his soldiers to build 15 miles of trenches around Vicksburg, Grant was able to starve the city for 47 days such that Pemberton was forced to surrender to the Union.

If you were a jedi during order 66 were would you hide?

Answers

Answer:

either the other side of the galaxy or a planet with no civilization that the empire cannot find

Explanation:

What did Mary Beth and John Tinker do at school that was found to be a protected form of expression by the Supreme Court?

Answers

C. They wore black armbands as a nonverbal show of protest.

edge 2021

Mary Beth and John Tinker wore black color armbands to protest against the war that happened in Vietnam.

Why did Mary Beth and John Tinker reach Court?

Mary Beth and John Tinker go to court to file a case against the school.She go to the supreme court for the benefit of free speech right as she got suspended by the school.

Mary Beth and John tinker have suspended by the school for showing protest against the Vietnam war by wearing black armbands. The supreme court has supported the right to free speech which helps them to win the case against the school.

Learn more about Mary Beth and John Tinker, here:

https://brainly.com/question/12082941

#SPJ2

In what city did nine African Americans go to school with an army escort?

A) Washington DC

B) Los Angeles, Ca

C) Birmingham, Alabama

D) Little Rock, Arkansas

Answers

Answer:

Little Rock, Arkansas.

Explanation:

what was life like in the south for african americans before civil rights movement

Answers

Answer:

terrible!

Explanation:

Please help again! I’ll give brainleast to whoever gives correct answer!

Answers

Answer:

B

Explanation:

They are usually elected by a political party.

Who was the first president of the Confederate States of America

Answers

Answer:

On November 6, 1861, Jefferson Davis was announced as president of the United States of America

Explanation:

He was the first President of the Confederate states of America.

hope this helps!

~mina

Answer:

Jefferson Davis.

Explanation:

How does Jefferson address the possibility that a future General Assembly could overturn this law?

Answers

Answer:

How does Thomas Jefferson address the possibility that a future General Assembly could overturn this law? "Act For Establishing Religious Freedom" riverasoto is waiting for your help

Explanation:

Jefferson argues that no human authority (civic or religious) should impose its religious views on individuals. Such impositions, according to Jefferson, “are a departure from the plan of the holy author of our religion,” and they “tend only to beget habits of hypocrisy and meanness” among the believers.

What are Jefferson's arguments for freedom of religion?

Jefferson believed that the Statute guaranteed religious freedom for “the Jew and the Gentile, the Christian and Mahometan, the Hindoo, and infidel of every denomination.” He believed that such broad freedom and tolerance were essential in a republic with people from different religions, ethnicities, and races.

Learn more about Act for Establishing Religious Freedom here https://brainly.com/question/2200062

#SPJ2

How did the Columbian exchange lead to the development of capitalism

Answers

Answer:

The Columbian Exchange caused population growth in Europe by bringing new crops from the Americas and started Europe's economic shift towards capitalism. Colonization disrupted ecosytems, bringing in new organisms like pigs, while completely eliminating others like beavers.

Explanation:

Hope it helps you!

just follow me for more!

I'm willing to help!

Answer:

Explanation:

The Columbian Exchange caused population growth in Europe by bringing new crops from the Americas and started Europe's economic shift towards capitalism.

Helped by the ONE & ONLY #QUEEN aka #DRIPPQUEENMO

Hoped this helped!! :)

Other Questions
How many minutes are there in 12.5 hours? 2. Which ethic do you think is most important for a journalist to have? Why? Write the relationship between cells, tissue and organs in human body.(plzzzzz answer correctly) At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? can somebody help please 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. The writer Angelo Pellegrini has recalled his own family's detention at Ellis Island:We lived there for three days -- Mother and we five children, the youngest of whom was three years old. Because of the rigorous physical examination that we had to submit to, particularly of the eyes, there was this terrible anxiety that one of us might be rejected. And if one of us was, what would the rest of the family do?The purpose of this excerpt is..A. to describe the physical examination experienced by an immigrant family.B. to explain the day-to-day schedule experienced by an immigrant family.C. to describe the fond memories experienced by an immigrant family.D. to explain the feelings of worry experienced by an immigrant family. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Help!!! I do not seem to understand this problem well. Why would an investor want to choose a certificate of deposit over a corporate bond describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver