What is the function of an interjection?

A. To tell a location or time
B. To join two ideas in a sentence
C. To describe a verb or a noun
D. To show emotion or feeling

Answers

Answer 1
B. To join two ideas in a sentence.
Answer 2

The function of an interjection is to show emotion or feeling. They don't follow the remainder of the statement correctly. D is the right option.

The ads within the code you gave are utilized to communicate the taking after feelings:

Wow! - Shocking

Goodness no! - Stun

Goodness, expensive! - Astonish

Here are some more pointers for efficiently using interjections:

Use them in moderation. It's crucial to utilize interjections cautiously since they might be misused. They will lose their impact if you use them excessively.

Use them to convey powerful feelings. Strong emotions are best expressed through interjections. You don't need to use an interjection if you're only a little bit joyful. However, if you're thrilled, adding an exclamation like "Hurray!" may dramatically improve your work.

Hence, the correct option is D. To show emotion or feeling

Learn more about interjection, here:

https://brainly.com/question/1633224

#SPJ6


Related Questions

Mom and Dad_to work everyday.
Drive or Drives ?

Answers

Answer:

Drive

Explanation:

Answer: Drive

Explanation:

Select the correct text in the passage.
Which statement best shows Brutus's attempt to appeal to his audience?
Julius Caesar
by William Shakespeare

Answers

Answer:

:)

Explanation:

What is correct to say....as a ladies in charge or....as a lady in charge?

Answers

Answer: "as a lady in charge"

[tex]\huge{\textbf{\textsf{{\color{pink}{An}}{\red{sw}}{\orange{er}} {\color{yellow}{:}}}}}[/tex]

" as a lady in charge " would be correct

thanks

hope it helps

4. PART B: Which detail from the text best supports the answer to
Part A?
O A “That word – 'guys'– might earn smiles and nods of
understanding in that world, but it brought the ultimate
insult in my neighborhood." ( Paragraph 5)
OB "With one boy in particular, my mother had to sit me down
and explain: 'Son, perhaps there's another reason why his
parents keep making excuses for why we can't get together."
(Paragraph 18)
O c "Painful as some of these experiences were, I was grateful to
have them in middle school and high school, so that when the
time came to head for college, I already had some fluency
navigating between different cultures" ( Paragkaph 12)
OD "I watched as too many others from my hometown and other
predominantly black cities struggled in a university setting
where suddenly they really were a minority." (Paragraph 20

Answers

Answer:

“With one boy in particular my mother had to sit me down and explain.”

Explanation:

Perhaps this one “boy” doesn’t want to be a boy anymore and gets offended when the main character refers to them as a “guy” or was never a guy to begin with. In that case it would make sense that the boy would get offended

True or false: The following sentence is correct?
“In thirty years,” Rodriguez claims, “we will all be in driverless cars.”
Select one:

True


False

Answers

Answer:

true

Explanation:

We can't know what will the next innovation of humanity. We managed to fly to other space, who knows if someone can create a driverless car.

Convert 77° F into kelvins.
Conversion Formulas
C° = (F° - 329) - 1.8
Fo= 1.8 x C° + 320
K= C° + 273

Answers

77° F converts into 298.15 in kelvins

please help please
Which of the following is NOT a basic belief or practice in Chinese Folk Religions?
Yin and Yang
Fasting
Filial Piety
Ancestor Worship

Answers

Answer:

ancestor worship is your answer to your question you have given

ancestor worship is the answer

I’m going To need your help on This no links on My question or I will report you

Answers

Answer:

1.D

2.C

3.C

4.B

Explanation:

1. Implode means to get smaller

2. Supernova is a stellar explosion

3. massive is large

4. light year is a time period

1) D. Becomes a tiny dot

2) C. The explosion of a start

3) C. Very large

4) B. How far light travels in one year


Hope this helps, I did my best.

Question 6
READ ITI
What happens because Kylo tries to get attention instead of being a
team player?
Nico scores the winning goal,
He is not voted Most Valuable Player
Jamol becomes the team's highest scorer
His team loses to the Cougars

Answers

Explanation:

he was not voted most valuable player

Which of the following expresses a fact?

Question 2 options:

a)

Eating fast food isn't bad if you only eat it once per week.


b)

Burning the American flag should be a crime.


c)

On average, college graduates earn more money in their lifetimes than high school graduates.


d)

Sometimes curly hair can look better than straight hair.

Answers

Answer:

C

Explanation:

C is a fact and it isnt an opinion

PLZ HELP ASAP John Bunyan was imprisoned because he was an Anglican minister.

True
False

Answers

Answer:

true

Explanation:

In the 1600s , the Angelic church was seemed as a treachery because some of it's structure does not fit the Traditional Catholic ( which was was imposed on all England). John Bunyan is one of the most famous Anglican Minister in the Era. A lot of European Angelic Churches honor his death on every August 31st 

Answer:

True

Explanation:

He was very nice and talked slow like Miss Kinnian does and he explaned it to me that it was a raw shok. He said pepul see things in the ink. I said show me where. He said think. I told him I think a inkblot but that wasnt rite eather. He said what does it remind you - pretend something. I closd my eyes for a long time to pretend. I told him I pretned a fowtan pen with ink leeking all over a table cloth. Then he got up and went out. —“Flowers for Algernon, Daniel Keyes

what characterizes Charlie in this passage

description of Charlie
what other people say about Charlie
how Charlie thinks ​

Answers

Answer:

C   ;how Charlie thinks ​

Explanation:

Answer:

The person overtop is right

Explanation:

Just to Clarify.

Why is the waste going to those countries instead of saying in the United States for recycling? In complete sentences

Answers

The correct answer to this open question is the following.

Unfortunately, you forgot to include the name of "those countries" that receive the waste from the United States. Without the names, we are limited to fully answer.

However, trying to help you we can comment on general terms based on our knowledge of this topic.

Many times the waste going to underdeveloped o poor countries instead of saying in the United States for recycling is because it is cheaper for the United States to send that waste abroad to those countries. Another reason is that environmental laws in the US are stricter than in other countries, so US industries have to invest more money to comply with United States environment regulations. So these industries prefer to pay to other recycling companies abroad.  

In those other countries, legislation is not as strict as in the US or sometimes environmental legislation is non-existent. The problem is that in these countries people, civilians, suffer the consequences.

Battle in your own words sentences

Answers

Answer: We lost many men in the long-lasting battle but in the end, we won. Our bruises and blood were washed away from the glory of winning. The death of our brothers was not in vain.

Other Questions
What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver This Question: 1 pt20 of 20This QuthThe pH of a fruit juice is 2.9. Find the hydronium ion concentration, [H30 * ), of the juice. Use the formula pH = -log[H30*]The hydronium ion concentration [H30 + ] is approximately moles per liter.(Use scientific notation. Use the multiplication symbol in the math palette as needed. Round to the nearest tenth as needed.) A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size When riding your bike on a main road you should always follow the rules of the _________.roadbikers guidewalkerstown they are riding in Can someone please help me on this plz I beg u :( Writing: Critique On Nutrition And Pregnancy. Critique a current article or website on Pregnancy and compare to good nutrition practices. 1) Evaluate the recommendations. 2) Compare the recommendations. Write a 300 or more on your findings and conclusions. ( Will Mark Brainliest). Mhanifa Plz help me with this thank you! Need help on doing escape room. How to escape from Emoji Planet. What is one service the Freedmen's Bureau provided for African Americans?The agency provided funds to pay poll taxes.The agency set up courts to settle land disputes.The agency taught them how to cultivate crops.The agency found employment in Northern cities. Which of the following is a proportion? 5. Consider kite HIJK. If HK = 8 and HP = 5, find KP.H. Complete the missing words. - Hablo espaol, ingls y francs.- _______________!Your answer:SoyPerfectoQuieroYo soy __________ de Matemticas.Your answer: jugador profesor mdicoYo soy __________ de Secundaria (high school).Your answer: estudiante trabajo mdicocan someone who speaks Spanish help