what is the diameter of a circle with a circumference of 27 centimeters?

Answers

Answer 1

Answer:

diameter = 8.6 cm

Step-by-step explanation:

diameter = 27/π = 8.6 cm


Related Questions

at a football game, every person is either a fan of the home team or of the visiting team. omar observes that the ratio of fans of the home team to fans of the visiting team is 7:2. omar states that the total number of fans at the game must be an odd number because 7 + 2 = 9 and 9 is an odd number.

Determine a number of fans of the home team and a number of fans of the visiting team that show omar statement is false.

the first question is, enter a number of fans of the home team that would show Omar's statement is false.

the second question, enter a number of fans of the visiting team that would show omar statement is false.



pls I need help!!!!!!​

Answers

14 fans for the home team and 4 for the away will still hold the ratio and prove Omar’s statement false.

PLZ ANSWER QUIKCLY
Which expression is equivalent to -12(3x-3/4)

-36x-8

-36x + 8

-36x-9

-36x +9

Answers

Answer:

Last one, -36x+9.

Explanation: You need to multiply negative times positive which is negative. But look at the last one -12×-3/4 equals positive 36/4 which equals 9.

Can you figure out the missing number​

Answers

Answer:

probably 6 thats one of the missing ones

What is 74 in standard form? O A. 11 OB. 28 Oc. C. 2, 401 O O D. 16,384​

Answers

Answer:

oc2

Step-by-step explanation:

because

find the surface area of the cube with 7 inches sides

Answers

Answer:

294

Step-by-step explanation:

surface area of a cube = 6* a^2

6 * 7^2

= 6* 49

= 294

Help for 20 points please

Answers

I think that the answers to this question is going to be B

Answer:

The Answer is 12 - 15= 129

Step-by-step explanation:

x2−15=129

Step 1: Add 15 to both sides.

x2−15+15=129+15

x2=144

Step 2: Take square root.

x=±√144

x=12

An architect is allowed 56 square yards of floor space to add a small bedroom to a house. because of the rooms design in relation to the existing structure, the lenght of the rectangular floor must be 6 yards less than 2 Times the width.Find the lenght and width of the rectangular floor that the architect is permitted

Answers

there would be 5 rooms because

Annabelle’s bicycle has a wheel radius of 13 inches. She places a sticker on the wheel so that its minimum height above the ground is 0.5 inches. When she rides her bicycle, the wheel completes 90 revolutions every minute. The sticker begins at its minimum height above the ground. Which equation models the height in inches of the sticker after x minutes? y = 0.5 sine (180 pi x) + 13 y = 12.5 sine (180 pi x) + 13 y = 0.5 sine (180 pi x minus StartFraction pi Over 2 EndFraction) + 13 y = 12.5 sine (180 pi x minus StartFraction pi over 2 EndFraction) + 13

Answers

Answer:

[tex]y=12.5 sin(180\pi x-\frac{\pi}{2})+13[/tex]

Step-by-step explanation:

In order to solve this we can start by drawing a sketch of the problem (see attached picture)

So fist, let's take the general form of a sinusoidal movement:

[tex]y=Asin(\omega x+\phi)+b[/tex]

where:

A= amplitude

[tex]\omega[/tex]= angular frequency

x= time

[tex]\phi[/tex] = horizontal shift

b= vertical shift.

In this case, the amplitude will be the maximum distance between the center of the wheel and the highest or lowest point of the trajectory, in this case:

A= 13in - 0.5in =12.5 in

The angular frequency is how many radians the wheel will turn in a minute, so we get:

[tex]\omega=\frac{90 rev}{min}*\frac{2\pi rad}{1 rev}[/tex]

[tex]\omega=180\pi rad/min[/tex]

Generally, the sin function will start at the center of the circular movement. In this case, since it starts on the lowest point, we can say that the graph moves right by [tex]\frac{\pi}{2} rad[/tex], so in this case:

[tex]\phi=-\frac{\pi}{2}[/tex]

and finally, the vertical shift is the distance between the center of the circular movement and the ground so in this case:

b=13in

so when putting it all together we get our equation to be:

 [tex]y=12.5 sin(180\pi x-\frac{\pi}{2})+13[/tex]

a) A car is purchased for $30000 and is depreciating at a rate of 12% per
year. Write an equation to represent this situation.
b) What is the car worth in 10 years?
c) How many years does it take for the car to be worth $1000

Answers

Answer: 187.5 gallons of gas

Step-by-step explanation:

He travels 30000 miles per year, and each gallon lets him travel 16 miles. Divide 30000 by 16 to get the amount of gas he uses in a year, which amounts to 187.5 gallons of gas.

12) A large box of crackers weighs 20 oz. If James needs 3 pounds of crackers for a
party, how many boxes of crackers should he buy?

Answers

Answer: about 3 boxes would be 3.50 lbs so idrk

Step-by-step explanation:

look at pic 10 pts will mark brainilest

Answers

Answer:

its a right angle and the area of it is 24

Step-by-step explanation:

Determine what type of solution the following equation has: 3(x-1)+5=3x+2

- No solution
- One solution
-Infinitely Many solution

Answers

If I’m not wrong it’s one solution because the sum of 3(x-1)+5=3x+2 is 0

Hope this helps!

Find the standard deviation. Round to the nearest tenth.
8, 17, 13, 8, 9, 13, 14, 5,5
A. 4.0
B. 1.3
C. 4.5
D. 4.2

Answers

Answer:

c

Step-by-step explanation:

Is is right?

what is the name of the shape depicted in the graph below
a. limaçon
b. rose
c. cardioid
d. lemniscate

Answers

Answer:

Limaçon

Step-by-step explanation:

In geometry, a limaçon or limacon /ˈlɪməsɒn/, also known as a limaçon of Pascal, is defined as a roulette formed by the path of a point fixed to a circle when that circle rolls around the outside of a circle of equal radius.

The name of the shape depicted in the graph below is a. Limacon.

What are Polar Curves?

Polar curves are the curves which are formed using the polar coordinate system.

The distance of the points from the origin will be varying depending on the angle from the positive X axis.

The given curves in the option Limacon, Rose, Cardioid, Lemniscate are types of polar curves.

Limacon is the curve which is also known as Pascal's snail. It is formed by following the path by a fixed point to a circle when this circle rolls another circle's of equal radius outside.

The given shape is the limacon with inner loop.

Lemniscate will always be a 8 shaped curve.

Hence the correct option is a, limacon.

Learn more about Polar Curves here :

https://brainly.com/question/27270742

#SPJ7

Solve the equation 23+n=29 using the inverse operation.

Answers

Answer:

n=6

Step-by-step explanation:

i used math-way :P

WILL GIVE BRAINLIEST!!!
In a test of hypothesis for a mean, which statement is CORRECT?

The population must be normal because that is the only case when the sample mean is Normally distributed.
As long as the population distribution consists only of positive values, sample size does not matter.
The population distribution can be any distribution because the sample mean is always Normally distributed.
The test requires that the sample mean is normally distributed; this requires that either the population distribution is Normal or the sample size exceeds 30.

Answers

Answer:

As long as the population distribution consists only of positive values, sample size does not matter.

Step-by-step explanation:

As long as the population distribution consists only of positive values, sample size does not matter.

This is a hypothesis because a hypothesis is basically a prediction of what's gonna happen; the other choices are mostly facts that can be backed up, this can only be confirmed after it happens since it can end in different ways. This is a prediction where it says that if the population distribution continues to go on to positive value, then the sample size won't matter; this can come out in different ways, the sample size could matter or it would have to be negative values, e.t.c. This has different ways it could end up.

the measure of an angle and its complements are 13x and 17x write an equation then solve​

Answers

Step-by-step explanation:

Aal kimoya iyah I love 18

Elizabeth planted a garden in a 16 foot by 8 foot area. To calculate the square foot area of the garden, she multiplied 16 by 8 and got a product of 128 square feet Which equation could Elizabeth use to check her answer? A) 16 x 8 = 128 B) 128 - 8 = 16 © 128 + 8 = 136 D. 128 - 8 = 120 please help​

Answers

B  128 divide 8 = 16

took test

Answer:

128 / 8 = 16

Step-by-step explanation:

The volume of this rectangular prism is 53.72 cubic centimeters . what is the value of y?

Answers

Answer:

y = 1.7 cm

Step-by-step explanation:

V= lwh

w = [tex]\frac{V}{lh}[/tex] = [tex]\frac{53.72 cubic centimeters}{4cm(7.9cm)}[/tex] = 1.7 cm

5 rubber stamps cost $9.70.
Which equation would help determine the cost of 11 rubber stamps?
A: x/11 = 5/9.70
B: 11\$9.70 = x/5
C: 5/11 = x/9.70
D: 11/5 = 9.70/x
E: None of the above

Answers

E None of the above

Factor the expression (x+4)^2-4y^5(x+4)+4y^10

Answers

if you factor this,
it is (x+4-2y^5)^2

Find the value of x.

Answers

answer: x=66
explanation: x+(x-20)+(2x+10)+(x+40)=360
5x+30=360
5x=330
x=66

write a mathematical equation and calculate the area of the irregular polygon

Answers

3)5/6)=x 36-508-7392


The functions f and g are defined as follows.
g(x) = -2x3-5
f(x) = - 4x + 2
Find f (6) and g(-3)
Simplify your answers as much as possible.

Answers

Answer:

f(6) = -22, and g(-3) = 49

Step-by-step explanation:

f(x) = -4x + 2

f(6) = -4(6) + 2

f(6) = -24 + 2

f(6) = -22

I assume the 3 in g(x) = -2x3 -5 is cubed

g(-3) = -2(-3)^3 - 5

g(-3) = -2(-27) - 5

g(-3) = 54 - 5

g(-3) = 49

ANSWER THE QUESTION FOR BRAINLIEST

Answers

Non linear means not a straight line so answer C or the third answer.

Answer:

not a straight line

Step-by-step explanation:

Linear has the word "line" in it. A linear relation has a graph shaped like a straight line.

Nonlinear means "not like a straight line".

Answer: not a straight line

thomas has 12 more marbles than twice the number of marbles Andrew has.
Andrew has x marbles. which expression represents how many marbles thomas has?
A. x + 2 + 12
B.x+12(2)
C.2x+12
D.2(x+12)​

Answers

Answer:

A.

x + 2 + 12

Step-by-step explanation:

Thomas (t) = Andrew (x) * 2 + 12

plzzzz help meeeeeeeeeeee

Answers

It is the 2nd one you’re welcome

ANSWER ASAP PLS

The circular opening of a tunnel has a circumference of 36 meters. Which equation can be used to find d, the
diameter of the tunnel opening in meters?

Answers

D = circumference divided by Pi

D = 36 divided by 3.14

D = 11.5

−2(5d−9f)+7f−10(−9f−7d)

Answers

Answer:

38

Step-by-step explanation:

What is the equation of a line with a y-intercept at (0, 2) and a slope of 3?
a. y = 2x + 3
C. y = 3x + 2
b. y = 3x - 2
d. y = -2x + 3

Answers

Answer:

answer is C

the slope is 3 and the intercept is (0,2) which is 2

Other Questions
2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. What is wrong with the claim statement: "Everyone should use a cell phone." In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! Please help! Thank you! what is the mRNA in TACCGGATGCCAGATCAAATC? Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. Why would an investor want to choose a certificate of deposit over a corporate bond describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! Explain the lifecycle of mosquito in short Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. Find the surface area of this prism.Round to the nearest tenth. why is it important to save energy in our daily lives Solve for x. Round your answer to the nearest tenth (one decimal place). Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver What classification is an E7018?will give brainliest I will mark Brainliest for frist answer