Use the Distance Formula and the Pythagorean Theorem to find the distance, to the nearest tenth, from T(2, –2) to W(–7, 3).

Answers

Answer 1

Answer:

10.3 units

Step-by-step explanation:

coordinate points are

T(2, -2) =(x1 , y1)

W(-7, 3) =(x2 , y2)

distance formula = [tex]\sqrt{(x2 -x1)^2 + (y2 -y1)^2}[/tex]

=[tex]\sqrt{(-7-2)^2 + {3-(-2)}^2[/tex]

=[tex]\sqrt{(-9)^2 + (3+2)^2[/tex]

=[tex]\sqrt{81 + 5^2[/tex]

=[tex]\sqrt{81 + 25[/tex]

=[tex]\sqrt{106[/tex]  

=10.29563014

=10.3 (after converting it to the nearest tenth)


Related Questions

What is the nth term rule of the linear sequence -5,-7,-9,-11,-13

Answers

Answer:

-7

Step-by-step explanation:

cause I took the test and got it right in my first try

Your rule for the sequence is -2n-3. Substitute any value for n and you will get the input. Hopefully this helps

Find the radical equivalent of 2723 and compute it.
ASAP PLS

Answers

Try 1.56 it should help!!

Which choice represents the simplified exponential expression?
(8^7)^5

Answers

Answer:

8^35

you multiply exponents of exponents meaning we multiply 7*5 which is 35

Step-by-step explanation:

What is the greatest common factor of 4 - 6а?

Answers

Answer:

GCF (4 ,6) = 2

Greatest common factor (GCF)

Step-by-step explanation:

Use 3.14 = 7 to find the volume of the composite shape below.
15 in
20 in
18 in
The total volume of this composite shape is

Answers

Awnser: 16022 in3

Step-by-step explanation:

find the volume of the 2 cones find the volume if the semicircle then add the 2 volumes together.

(ii) Using a calculator, or otherwise, determine the exact value, to one decimal place, of 8792-6886 12 X 9 ​

Answers

Answer: I did it in the explanation thingy-

Step-by-step explanation:

Step 1. 8792 - 6886 = 1906

Step 2. 12 x 9 108

That... OR the answer is 205848X

Pls help me with this!

Answers

Answer:

5 ÷ 1/3

5 × 3/1

5 × 3

=15

Step-by-step explanation:

the answer is 15

I need help ASAP I wasn’t paying attention and lowkey forgot all of this

Answers

Answer:

35

Step-by-step explanation:

Only if u put x as 35 will the whole triangle sum equal 180 as necessary for the theorem to be true.

Pls help me with this it's urgent!

Answers

Answer:

function is the correct answer

Answer:

an = a1 + (n - 1 ) d (Function)

Step-by-step explanation:

This is the formula that will be used when we find the general (or nth) term of an arithmetic sequence. So it is function

pls help me pls and thank u

Answers

94 step by step below

What is the solution set of the equation
x + 6 = 2(x + 3) - x?

Answers

Answer:

x = all real numbers

General Formulas and Concepts:

Pre-Algebra

Order of Operations: BPEMDAS

Brackets Parenthesis Exponents Multiplication Division Addition Subtraction Left to Right  

Distributive Property

Equality Properties

Multiplication Property of Equality Division Property of Equality Addition Property of Equality Subtraction Property of Equality

Algebra I

Terms/Coefficients

Step-by-step explanation:

Step 1: Define

Identify

x + 6 = 2(x + 3) - x

Step 2: Solve for x

[Addition Property of Equality] Add x on both sides:                                     2x + 6 = 2(x + 3)[Distributive Property] Distribute 2:                                                                 2x + 6 = 2x + 6

Here we see that both sides are identical.

∴ our solution is all real numbers.

The given lengths are two sides of a right triangle. All three side lengths of the triangle are integers, and together they form a Pythagorean triple. Find the length of the third side, then indicate whether it is a leg or a hypotenuse.

Answers

Answer:

C) 92, leg

Step-by-step explanation:

a² + 28² = 96²     *the hypotenuse is always the longest side

a² + 784 = 9216

a² = 8432

a = √8432

'a' is approximately 92, and is a leg

Hey can someone help with this? It’s Khan Academy
Aka suffering.
Thanks.
-Tornado

Answers

Answer is B.
3n+3 djjdjdj

Answer:

3n+3

hope it helps

6th grade math help me pleaseee

Answers

Answer:

$0.27

However answered below me is correct. I divided backwards.

My apologies. It is 5am here locally and I've been up doing math for too many hours.

Unit price = Total cost divided by quantity

Unit price = 1.91 ÷ 7= 0.2728571429

rounded to the nearest cent $0.27

Answer:

27 cents

Step-by-step explanation:

Step 1: Subtract 3 from both sides of the inequality.
Step 2: __________
Step 3: Divide both sides of the inequality by the coefficient of x.

What is the missing step in solving the inequality 5 – 8x < 2x + 3?

Answers

Answer:

I’m gay

Step-by-step explanation:

Answer:

Add 8x to both sides of the inequality.

Step-by-step explanation:

I got it right

Mike works h hours in a week. To find his weekly pay he multiplies his hours by his pay of $30 per hour and adds $5 for his sales bonus. He's decided that he wanted to take one-fifth of his weekly pay and place it in his savings. Which simplified expression represents the amount that will go into his savings each week?

Answers

Answer:

6h + 1

Step-by-step explanation:

number of hours: h

pay per hour: 30

pay for the hours: 30h

add sales bonus: 30h + 5

1/5 of total above: (1/5)(30h + 5) = 6h + 1

Answer: 6h + 1

help me please: tan3x-tanx-1=0



Answers

Answer: [tex]x=0.30714\dots +\pi n[/tex]

Step-by-step explanation:

[tex]\Rightarrow \tan3x-\tan x-1=0\\\\\Rightarrow \dfrac{3\tan x-\tan ^3x}{1-3\tan ^2x}-\tan x-1=0\\\\\Rightarrow 3\tan x-\tan ^3x+( 1-3\tan ^2x)(-1-\tan x)=0\\\Rightarrow 3\tan x-\tan ^3x-1-\tan x+3\tan ^2x+3\tan ^3 x=0\\\Rightarrow 2\tan ^3x+3\tan ^2x+2\tan x-1=0\\\Rightarrow \tan \left(x\right)\approx \:0.31718[/tex]

What is the y-intercept of the graph below?

Answers

Answer:

D. (0, -1)

Step-by-step explanation:

Answer:

D. (0, -1)

Step-by-step explanation:

What is the measure of the unknown angle?

Answers

To determine to measure of the unknown angle, be sure to use the total sum of 180°. If two angles are given, add them together and then subtract from 180°. If two angles are the same and unknown, subtract the known angle from 180° and then divide by 2.

What should be the first step in adding these equations to eliminate y?

Answers

Answer:

D

Step-by-step explanation:

Answer:

D

Step-by-step explanation:

Since you want to eliminate y, the y value on the bottom equation has the be the opposite of the y value on the top one. So it's 4y on the top one, so the bottom one has to be -4y to eliminate y. The bottom one is -2y, so -2 times 2 =-4, so multiply the bottom one by 2 omg i miss linear combination

How many solutions are there to the following equation?
2- 5x= 3(2 – 3x)
A. O
B. 1
C. Infinitely many

Answers

the answer should be c

The area of a rectangular parking lot is 3960 m²
If the length of the parking lot is 72 m, what is its width?

Answers

Answer:

3816m

Step-by-step explanation:

72 + 72= 144

8960 - 144= 3816

Rearrange the following numbers in order from least to greatest.

2, -7, 3, -9, -14, -8, 0, -10, -25


will mark the best answer or 1st answered brainliest or whatever

Answers

Answer:

-25, -14, -10, -9, -8, -7, 0, 2

Step-by-step explanation:

You do thing and it work

-25 , -14 , -10 , -9 , -8 , -7 , 0 , 2 , 3

solve m-13=8 please help me

Answers

Answer: 5

Step-by-step explanation:

13-8=5

5-13=8

If m and n are two natural number and m^n =8,then n^mn is.​

Answers

Answer:

729

Step-by-step explanation:

M has to be 2 and n has to be 3, because 2^3 = 8

if it was 3^2 it would be 9

2^3 = 8

3^(2*3) = 3^6 = 729

If my answer is incorrect, pls correct me!

If you like my answer and explanation, mark me as brainliest!

-Chetan K

Teresa tiene 12 años , su hermano pere tiene 7 y su padre 44. QUANTOS AÑOS TIENE Q PASAR PARA Q LA SUMA DE LAS EDADES DE TERESA Y SPERE SEAN IGUALES

Answers

Answer:

Tienen que pasar 25 años para que la suma de las edades de Teresa y Pere sean iguales a la edad de su padre.

Step-by-step explanation:

Dado que Teresa tiene 12 años, su hermano Pere tiene 7 y su padre 44, para determinar cuántos años tienen que pasar para que la suma de las edades de Teresa y Pere sean iguales a la edad de su padre se debe realizar el siguiente cálculo:

12 + 7 = 19

44 - 19 = 25

44 + 25 = 69

(12 + 25) + (7 + 25) = 37 + 32 = 69

Por lo tanto, tienen que pasar 25 años para que la suma de las edades de Teresa y Pere sean iguales a la edad de su padre.

Brainliest goes to whoever answers correctly and explains also if you want extra points answer my other questions

Answers

Answer:

Step-by-step explanation:

126 + 44 = 170 ( total for under 25s)

186 - 56 = 130 (online for 25s - 50s)

154 - 58 = 96 ( in stores for aboves 50s)

314 for ONLINE TOTAL

196 for IN STORES TOTAL

510 for TOTAL TOTAL

A = 170

B = 56

C = 96

D = 96 - 58 = 38

E = 314 - 196 = 118

F = 510

hii i would like help for the question

Answers

Answer:

I have the same doubt so pls answer

Step-by-step explanation:

HI I NEED HELP ASAP I GIVE BRAINLEST IF YOU GET IT RIGHT

Answers

It’s c :) I did the test just trust me

the volume of this triangular prism is ….. cubic inches. please someone help, will give brainliest asap just explain how❤️❤️❤️❤️❤️

Answers

Answer:

I think the answer is 278.85

Step-by-step explanation:

Answer:

278.85

Step-by-step explanation:

Other Questions
Lighting is the movement of? A business manager finds that the building expense each month is completely uncorrelated with revenue levels. What should the business manager assume about this cost? What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience. how can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededhow can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededOrder the sequence of events in transcription?1- free ribonuleotide triphosphates base-pair with the deoxyribonucleotides in the DNA template 2- RNA polymerase binds to the promoter region of a gene3- primary rna transcript is formed 4- two DNA strands are seperatedWhich organic molecule is not found on the plasma membrane?A. carbohydratesB. cholestrolc. phospholipidsd. proteinsWhat does this statement mean : "Information flow between cells tissues and organs is an essential feature of homeostasis and allows for integration of physiological processes"A. the nervous system is the most prominent body system for integration of physilogical processes B. some substances can affect local processes while others travel to exert their effects on other distant parts of the bodyC. communication between body structures through body fluids is the most important physiological processesD. Neurotransmitters, hormones, paracrine and autocrine substances exert their efferts locally as well as distant body structureswhich statement best describes the orientation the phospholipid molecules in a membrane:A.) the nonpolar fatty acids are oriented towards the cholestrol moleculesB.) the hydrophilic layer is oriented towards the middle of the phosphlipids C.) phospholipids align themselves in the membrane in a bimolecular layerD.) the hydrophobic and hydrophilic structures point away from the cellWhich is NOT a product of glycolysis under aerobic and anaerobic conditions?A.) lactate B.) FADH C.) pyruvate D.) NADH Which reason is why water is an essential nutrient? A.) water needs to move between compartmentsB.)can be obtained through ingestionC.) body cant make enough water for its needsD.) water evaporates from the skin that has the largest surface area among all body structures From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Tia and Sam are partners who solely own T and S Florist. As owners, they can:______.a. claim the organization as their legal property. b. can't sell the company. c. claim only limited liability. d. avoid taking any legal responsibility for T and S. e. decide not to pay a dividend to their stockholders. HELP ASAP 30 POINTS WORTH !!!!! OO The slope of a line is 2. The y-intercept of the line is 6. Which statements accurately describe how to graph the function? Locate the ordered pair (0, 6). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (0, 6). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points. Please help!!!hi,can you please help me with this?thanks can someone answer this please one of the main ways that federal and state courts differ is the process of discovery that is required in each court. true or false? g If the beginning work in process includes 200 units that are 20% complete with respect to conversion and 30% complete with respect to materials. Ending work in process includes 100 units that are 40% complete with respect to conversion and 50% complete with respect to materials. If 1,000 units were started during the period, what are the equivalent units of productions for the period (using the weighted-average method) for conversion What is the reporters motive in article 1?What is the reporters motive in article 2?Which term from Senator Nelsons quote in article 2 is an example of bias? Help Me please!!!!! Rn calculate the mass in 4.05*10^22 molecules of calcium phosphate Which event is inferred by most scientists to be responsible for a climate change that has recently led to a decrease in the size of most glaciers? * a decrease in the rate of divergence of lithospheric plates along a mid-ocean ridge O a decrease in the amount of insolation reaching Earth's surface an increase in the amount of greenhouse gases in Earth's atmosphere an increase in the amount of vegetative cover in the tropics How is an ammeter connected in a circuit to measure current flowing through it? can someone please explain how to complete this thanks