Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]

Answers

Answer 1

Answer:

- Protein sequence: Met-Pro-Gly-Lys-Ile-Arg-Arg-Pro-Pro-Gly-Thr-Pro-Leu-Phe-Gly-Lys-*

- DNA 5' UTR: ATTTTAGCC

- RNA 3' UTR: UAAAAAUAAAAU

Explanation:

Transcription is the process in which a DNA sequence (e.g., a gene) is used as template (transcribed) in order to synthesize an RNA molecule, usually a messenger RNA molecule, which is then used as template to produce a polypeptide sequence (protein) in the ribosomes. In RNA, Thymine (T) bases are always replaced by Uracil (U) bases. An mRNA strand is formed in the 5′ to 3′ direction. Each triplet of nucleotides is referred to as a codon and the resulting mRNA strand is translated starting from codon AUG (Methionine), while there are three different stop codons or 'or termination codons' in the genetic code that terminate translation: UAG, UAA, and UGA.


Related Questions

El estómago es un órgano parecido a un saco que contiene los alimentos y comienza a digerirlos segregando jugo gástrico. ¿De qué sistema o aparato es parte el estomago? *

Answers

Answer:

Sistema digestivo

Explanation:

Los principales sistemas del cuerpo humano son:

Sistema respiratorio, sistema circulatorio, sistema nervioso, sistema inmune, sistema digestivo, sistema óseo, sistema urinario, sistema reproductor y sistema muscular.

Como dice el enunciado, el estómago comienza a digerir los alimentos haciendo parte, así, del sistema digestivo cuya función es digerir los alimentos y absorber sus nutrientes.

write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond​

Answers

(See the attached picture)

Direction: Write a short story on the journey of a sperm cell seeking to enter in a egg cell to share life together as a zygote and beyond.

Answer:

The goal of the sperms’ journey to the egg is to fertilize it. To do so, the sperm cell must pass through a long and challenging path. This is one of the reasons why the total number of motile sperm cells is very important, and a key parameter for a man’s potential to reach pregnancy with his partner.

The sperms’ journey to the egg begins with millions of sperm cells that are released into the female reproductive tract during intercourse. The sperm cells gain their full ability to swim when they are ejaculated into the reproductive tract.

Upon ejaculation, the sperm cells are enclosed in a fluid called seminal plasma or semen, which is a mix of fluids from the testes, seminal vesicles, prostate, and the bulbourethral glands. The fluid contains elements which protect the sperm cells during their journey towards the egg. The semen thickens and helps the sperm cells stay inside the woman – as close as possible to the cervix, which is the “gate” to the egg.

Liquid extends from the cervix, allowing the sperm cells from the semen to swim into the cervix. Only the strongest sperm cells will make it this far. Once through the cervix, the sperm cells swim across the uterus and into the fallopian tubes.

I hope it helps!!

The sperm cell fertilizes the egg and forms a zygote, which is further divided into multiple cells and becomes a child. The division is the process of mitosis that takes place from the zygote to the child's development.

How is the zygote formed and developed?

The sperm and the ovum are produced by the process of meiosis from the male and female, respectively, and when both fertilize, the zygote is formed. The fertilized zygote is a single cell, but later that cell is further divided mitotically and forms a morula, then a blastula, and then the gastrula.

The cells of the gastrula undergo cell differentiation, different organs are developed, and the baby is finally formed. The child then continues to grow in size, and different organs grow and form the mature organ system. After a certain age, the reproductive organs start to mature and are capable of forming the gametes.

Hence, all of these events occurred from the zygote to the child's maturity.

Learn more about the zygote here.

https://brainly.com/question/465851

#SPJ2

Summary of human nutrition ​

Answers

Answer:

Human nutrition is the process of which substances are Transformed into tissues and energy which are used up to mental and physical activities!

What was Darwins “
master work” titled

Answers

Answer:

Origin of Species by Means of Natural Selection

If earth’s atmosphere is made up of 78% nitrogen, why is nitrogen a limiting factor for producers?
A.
Consumers respire all of the available nitrogen.

B.
Nitrogen is unusable in its liquid form.

C.
There are more plants than gaseous nitrogen.

D.
Nitrogen is unusable in its gaseous form.

Answers

d is the answerrrrrrrrrr

Trastorno alimenticio caracterizado por una gran pérdida de peso, que el propio paciente se provoca y que puede conducir a un estado de inanición.

Answers

Answer: Anorexia nerviosa.

Explanation:

La anorexia nerviosa es un trastorno o desorden alimenticio en donde se produce un rechazo de la comida debido a un temor excesivo a subir de peso, llegando a un estado de inanición serio. Entonces, se produce un deterioro en la salud y una debilidad causada por una ingesta insuficiente de nutrientes causando una desnutrición que altera diversas funciones del organismo. Es mas común en mujeres jóvenes o adolescentes aunque se reportan casos en ambos sexos y a cualquier edad. No debe confundirse con otro trastorno llamado simplemente anorexia, que es un síntoma que se caracteriza por una falta de apetito debido a alguna causa orgánica.

Este trastorno puede ocurrir por diversas causas que vienen acompañadas por una distorsión de la imagen corporal propia, en donde la persona considera que debe perder más peso de lo que se considera saludable y normal para su edad y estatura, llegando a estados raquíticos. También hay muchos casos en donde además de una dieta extrema, se realice ejercicio de manera excesiva o que utilicen otros métodos para bajar de peso como el abuso de laxantes u otros medicamentos.

 Algunos factores de riesgo para el desarrollo de la anorexia nerviosa pueden ser:

Personalidad perfeccionistaImagen propia negativa o baja autoestimaPresiones socialesPadecer algún trastorno de ansiedad

which process produce two genetically distinct haploid cells

Answers

Answer:  mitosis

Explanation:

When and where would you expect to find the highest rate of primary productivity

Answers

Answer: Net primary productivity is the amount of gross primary productivity remaining after respiration, which is about 40 and 85 percent. Sloughs and marshes, as well as tropical rain forests, possess the highest rates of net primary productivity; deserts have the lowest.

Explanation:

I explained on the top-

The highest rate of primary productivity in terrestrial environments takes place in swamps and marshes and in tropical rainforests, and in aquatic environments it takes place in algal beds, estuaries, and reefs.  

• In ecology, primary productivity refers to the rate at which conversion of energy to organic substances takes place by the photosynthetic producers that attain energy and nutrients from the sunlight, and chemosynthetic producers that attain chemical energy via oxidation.  

• The majority of the energy assimilated by plants via the process of photosynthesis is not stored as organic substance, however, is utilized at the time of cellular respiration.  

• In the process, the organic components like proteins, carbs, and fats are dissociated to provide energy in the form of ATP for the metabolic needs of the cells.  

• The energy not utilized is stored in the tissues of the plants for future use and is known as the net primary productivity.  

• The highest net primary productivity in terrestrial environments takes place in marshes and swamps and in tropical rainforests, and in aquatic environments it takes place algal beds, estuaries, and reefs.  

These environments are mainly critical for the sustenance of global biological productivity.

To know more about:

https://brainly.com/question/14017102

pushing a chair requires less energy than pushing than pushing a desk because

A. The surface area of the desk is larger.

B. The desk has less mass then then the chair

C. The chair has less mass then the desk

D. The chair is smaller

Answers

Answer:

c

the chair has less mass then the desk

Starch is a polysaccharide used as a component of cell walls in plants.


True

False

Answers

Answer:

false

Explanation:

is type of carbohydrates

False. Starch is a polysaccharide used as an energy storage molecule in plants, but it is not a component of cell walls.

What are structural component of cell wall?

Cell walls are structural components found in the outermost layers of cells in plants, fungi, and some bacteria. They provide support and protection for the cell, and are composed of a variety of different biomolecules, including cellulose, pectin, and lignin.

Starch, on the other hand, is a complex carbohydrate that is synthesized and stored in the cells of plants, particularly in the seeds, roots, and tubers. It is made up of long chains of glucose molecules and is used by plants as an energy source, particularly during times when the plant does not have access to light for photosynthesis. Starch is not a component of cell walls.

Learn more about cell wall, here:

https://brainly.com/question/965751

#SPJ2

A single species can feed at only one tropic level

True

False

Answers

Answer: True sorry if I’m wrong.

Explanation:

Answer:

True

Explanation:

Which of the following best represents the purpose of fertilizers?

Answers

Answer:

Fertilizer, natural or artificial substance containing the chemical elements that improve growth and productiveness of plants. Fertilizers enhance the natural fertility of the soil or replace the chemical elements taken from the soil by previous crops.

what is a halflife in science?

Answers

One-half of the atomic nuclei of a radioactive sample to decay

the water in ponds and lakes is...

Answers

Answer:

freshwater

Explanation:

Answer:

Lakes and ponds are inland bodies of standing or slowly moving water.

hope it helps

Each Taxonomy (category) gets less and less specific as they go further down the list.

A. True

B. False

Answers

Answer:

B. False

Explanation:

The levels of classification, from broadest to most specific, include: kingdom, phylum, class, order, family, genus, and species.

Answer:

B. False

Explanation:

Taxonomy is the study of the general principles of scientific classification.

i need help with this question

Answers

Research Question: How does various water types affect the growth of plants?

Independent Variable: Type of water

Dependent variable: plant growth

Constants: Time period (2 weeks)

Controls: type of plant, amount of soil, etc (anything you want to remain constant throughout).

I’m confused help me pls

Answers

Claim: This process uses expensive fertilizers and pesticides to grow pest free crops which may be produced in excess. Explain the reasons why people would go against growing wheat this way.

Your answer: Here are 3 reasons that go against growing wheat this way.

1. The fertilizers and pesticides are expensive and cost farmers a lot which takes away from the revenue that farmers make from growing the crops in the first place.

2. Other then fertilizers and Pesticides its a lot of work as you can see on the chart throughout the year there are many things you must do too keep crops bug free and pest free this reason I'm explaining says that taking and doing all of this work for not pests/bugs is too much and not needed.

3. Fungicide Is needed a lot and incredibly expensive when you used/spray it on crops that much and point goes a lot more for large crops too.

If these reasons don't work, find factors that or counterclaims that go against this method of harvesting wheat. (This is what your supposed too do)

what are the effects of a change in protein? there is 3

Answers

Generally, mutations result in reduced protein function or no protein function. A mutation with reduced function is called a leaky mutation because some of the wild-type function “leaks” through into the phenotype. A mutation that results in no protein function is called a null mutation

is eczema recessive or dominant? explain why or how.

Answers

Answer:

When caused by CARD11 gene mutations, atopic dermatitis has an autosomal dominant inheritance pattern , which means one copy of the altered CARD11 gene in each cell is sufficient to cause the disorder.

Explanation:

pls mark brainlest

Which of these organs are parts of the brain?
а) cerebrum
b) cerebellum
c) brainstem
d) all of above

Answers

Answer:

all of above

Explanation:

The answer is all of above







Crossing over occurs during Prophase II.

A. True

B. False

Answers

False
crossing over occurs in prophase 1 of meiosis 1. The significance of this crossing over is to ensure cell differentiation. If this occurred in prophase two it means the cells in meiosis 1 will be identical.

Answer:

B. False

Explanation:

Crossing over not occurs in prophase II. It occurs only during prophase I.

Which of these is an abiotic factor in a rainforest ecosystem?
Tree cover
Biodiversity
Trophic levels
Precipitation

Answers

I'd say precipitation, it won't be alive though so biodiversity is wrong

The skull and vertebrae are part of the _________ in vertebrates. circulatory system endoskeleton nervous system exoskeleton Science

Answers

Answer:

Endoskeleton

Explanation:

Hope this helps!

Answer:

nerveos systum i think is tha anser

Because it is ______ , fermentation _______ oxygen.



Answers:
aerobic/requires
anaerobic/requires
aerobic/does not require
anaerobic/does not require

Answers

Answer:

anaerobic/does not require

Explanation:

anaerobic occurs in the absence of oxygen

Which of the following is NOT an example of natural selection? *
A. Plants with thorns are less likely to be eaten by herbivores than other members of the same species that lack thorns.

B. Bacterial populations in hospitals develop resistance to drugs used to combat infection by them.

C. Scientists breed cows that give greater amounts of milk than their ancestors.

D. Fruit fly larvae with an enzyme to break down alcohol are better able to feed on fermenting fruit than those that lack the enzyme.

E. Female fish that produce more eggs leave more offspring than those that produce fewer eggs.

Answers

Answer:

The Answer is C

Explanation:

When scientists breed cows to produce more milk, this has not occured naturally and thus is not natural selection.

Answer:

C. Scientists breed cows that give greater amounts of milk than their ancestors.

Explanation:

The scientists breed cows that give greater amounts of milk than their ancestors is not an example of natural selection. So, option (C) is correct.

Explain how different types of cells help organisms live and grow?
Different types of cells have different jobs that are necessary to keep organisms alive.
Different types of cells are only found in specific types of organisms.
Cells are necessary in order for all organisms to grow big and hunt for their food source.
Cells provide support for all organisms to be able to move.

Answers

Answer:

Different types of cells have different jobs that are necessary to keep organisms alive. And cells also give the living animal more support. They also hold the genetic information of that organism in their nucules. This is with most cells but bacteria cells do not contain nucules.

When comparing fossil A to fossil B, which is most likely correct?
Air
Soil
Up
Fossil A
-Fossil B

Answers

Fossil B would most likely be correct in this situation

What are the non-living components of an ecosystem?

Answers

Answer:

- Abiotic factors refer to non-living physical and chemical elements in the ecosystem.

- Abiotic resources are usually obtained from the lithosphere, atmosphere, and hydrosphere.

- Examples of abiotic factors are water, air, soil, sunlight, and minerals.

What is the difference between gene mutations and chromosome mutations?
A. Gene mutations are preventable and chromosome mutations are not

B. Gene mutations can happen easily and chromosome mutations are more difficult

C. Gene mutations only affect one gene while chromosome mutations affect many genes

Answers

Answer:

C. Gene mutations only affect one gene while chromosome mutations affect many genes.

Explanation:

The difference is that the gene mutations only affect one gene while chromosome mutations affect many genes.

The diagram above illustrates the carbon cycle. Which of the Following components of the diagram represent carbon sinks?
A. marine photosynthesis and respiration
B. volcanoes and soil carbon
C. oceans and fossil carbon
D. factories and photosynthesis

Answers

Answer:

D) Factories and Photosynthesis

Other Questions
What is the result of subtracting the second equation from the first Pls name a set of vertical angles in the image below: Which of these random samples represents a representative sample of the number of students who enjoy science class?A. 30 students in the lunchroom.B. 30 students who failed science class last year.C. 30 students who received high grades in their science class last semester.D. 30 students who participated in the science fair. Find C.Round to the nearest tenth.20 ft)22 ftB18 ft find distance between (0,6) and (8,0)with process....... If a train traveled 400 miles north and traveled back 275 miles south and the total trip took 5 hours to complete, what was the average velocity of the train in mph? PLEASE HELP! WILL MARK BRANLIEST!The amount of carbon today is the exact amount that has always been on Earth. T or F Of the 5 ships he bagan his voyage with how many return to Spain?a1b2 3d4e5 Listen to the audio clip. What does the phrase mean? A. what else B. one must C. it's necessary D. again Why did the united states and the soviet s end up on opposite sides of the cold war? What was Jean-Jacques Rousseau's contribution to the Enlightenment duringthe 17th century?A. His theory of separation of powers formed the basis for France'snew government.B. He was the charismatic military leader of the rebels during theFrench Revolution.C. He mentored Napoleon Bonaparte, convincing him to experimentwith democracy.D. His ideas on government influenced how people believed ademocracy should function. Consider the video and advertisements that you've seen. Now, write a script to advertise any product of your choosing. The product can be real or fictitious. Use figurative language as a rhetorical device to enhance the persuasiveness of your advertisement. Also, consider your audience. To improve on your advertisement, start by creating an outline, then review and revise your first draft. If you have access to recording equipment, you may also try to record and present your advertisement as a radio spot. What was the effect of the battle of gettysburg on troop strength PLEASE HELP!! ILL GIVE MORE POINTS TO THE FASTEST ANSWER please help thank you Read the excerpt.After a strenuous climb, the hikers decided to make camp before reaching the summit because night was approaching rapidly.Which statement most accurately describes this excerpt?It contains two dependent clauses and one independent clause. It contains one independent clause.It contains one dependent clause and one independent clause.It contains one independent clause and two dependent clauses. According to your textbookSelect one:a. all motivation comes from the desire for external rewardsb. today's motivation researchers emphasize the biological drives thatguide behaviorc. human motivation is based entirely on psychological goals, notbiological needsd. drive theories do not account for the full complexity of humanmotivation Out of 350 applicants for a job, 158 are female and 66 are female and have a graduate degree. Step 2 of 2 : If 110 of the applicants have graduate degrees, what is the probability that a randomly chosen applicant is female, given that the applicant has a graduate degree An intelligence signal is amplified by a 65% efficient amplifier before being combined with a 250W carrier to generate an AM signal. If it is desired to operate at 50% modulation, what must be the dc input power to the final intelligence signal amplifier 1: Qu es la Tomatina?A: Festival que se celebra en Mxico anualmente.B: Ninguna de las anterioresC: Festival que se celebra cada el ltimo viernes de cada agosto en Espaa.D: Festival internacional del tomate2: De dnde vienen los visitantes que celebran esta tradicin?A:Los visitantes vienen del norte de Mxico.B: Ninguna de las anteriores.C: Los visitantes vienen de otras partes de Europa.D: Los visitantes vienen de todas partes del mundo.3: Verdadero o Falso. La ciudad de Buol es grande con muchos habitantes. True or False4: Verdadero o Falso. Alrededor de cien mil toneladas de tomate si tiran durante la celebracin en la calle.True or False5: A qu hora comienza el festival? A: Ala una de la maana.B: Ninguna de las anterioresC: Alas doce del medio da.D; A las once de la maana.6: En dnde empieza la batalla de tomates? A: En el mercadito del puebloB: En la plaza del puebloC: En el centro comercialD: En las afueras de la ciudad7: Verdadero o Falso. Los tomates usados para la celebracin, vienen de la regin de Extremadura en Espaa donde estos son cultivados especialmente para el festival.True or False8: Las siguientes son todas actividades que ocurren durante el da de la celebracin, excepto?A: concursos de PaellaB: bailesC: corrida de torosD: desfilesE: msica