Tyler pays $22.10 for 2.6 pounds of chocolate covered cherries. What is the price per pound of the chocolate covered cherries?

Answers

Answer 1

Answer:

$8.50

Step-by-step explanation:

[tex]\frac{y}{22.10} =\frac{1}{2.6}[/tex]

2.6 × y = 22.1 × 1

2.6y = 22.1

2.6y ÷ 2.6 = 22.1 ÷ 2.6

y = 8.5

Answer 2

Answer: 8.50

Step-by-step explanation: 8.50

Step-by-step explanation:

Divide $22.10 over 2.6 pounds of covered cherries


Related Questions

5. Write two fractions that are equivalent to
10. Describe how you can show they are
equivalent.

Answers

Answer:

equivilent to what?

Step-by-step explanation:

The conversion of stored potential energy into kinetic energy can also be harnessed to power homes, factories and entire cities. Which example from the text supports this conclusion?
A the softball pitcher
B the slingshotting comet
C the archer
D the Hoover Dam
NO BOTS or SCAM PLS

Answers

I believe it would be the Hover dam because the question talks about powering homes and factories in which the hover dam dose.


Find the arc length. Leave your answer in terms of pie no links

Answers

Answer:

7/2[tex]\pi[/tex]

Step-by-step explanation:

Help me pleaseeeeeeee

Answers

Answer:

10

Step-by-step explanation:

Which graph best represents the equation 2x + 4y = -8?

Answers

Answer:

y = -1/2x - 2

Step-by-step explanation:

2x + 4y = -8

4y = -2x - 8

y = -1/2x - 2

I'll give you brainiest if you help me.

Answers

Answer:

88 degrees.

Step-by-step explanation:

Since AB is equal to BC, ABC is an isosceles triangle. Therefore, the angle of B will be 180-39-39=102 degrees. As the angle of a straight line is 180 degrees, take 180-102-32=46 degrees. This 46 degrees is angle B. Since DEB is an isosceles triangle, 180-46-46=88 degrees. 88 degrees is angle E which is your answer. Edit: (Just added on the explanation.)

6. Select all expressions that are equivalent to 1/2 to the third power.
Answer choices:
1/2 half but 2 is divided by 3.
1/8
1/3 to the second power
1/6
1/2x1/2x1/2

Answers

.5^3=0.125

Hope this helps.

Convert the number to standard notation.
3.8 x 10^-6

Answers

Answer:

3.8E-6

Step-by-step explanation:

How many choices do you have for your lunch if you pick either an orange or apple and pretzels or carrots to go with your sandwich?

Answers

Answer:

4

Step-by-step explanation:

So you can have

An orange + pretzels

An orange + carrots

Apple + pretzels

Apple + carrots

I think this is what they are asking for but I'm not sure

If the probability that the Islanders will beat the Rangers in a game is 78%, what is
the probability that the Islanders will win at least five out of six games in a series
against the Rangers? Round your answer to the nearest thousandth.
Answer:
Submit Answer

Answers

Answer:

(17/25)^5 = 0.145393 = 14.539%

Step-by-step explanation:

78% = 78/100 or 17/25 simplified

probability of winning each game is 17/25

The probability that the Islanders will win at least five out of six games in a series against the Rangers is 0.4.

What is probability?

Probability deals with the occurrence of a random event. The chance that a given event will occur. It is the measure of the likelihood of an event to occur.The value is expressed from zero to one.

For the given situation,

The probability that the Islanders will win the Rangers in a game = 78%      ⇒ [tex]0.78[/tex]

The probability that the Islanders will lost the Rangers in a game is

⇒ [tex]1-0.78=0.22[/tex]

The probability that the Islanders will win at least five out of six games in a series against the Rangers is

⇒ [tex]6C_{5} (0.78)^{5}(0.22)^{1}[/tex]

⇒ [tex](6)(0.2887)(0.22)[/tex]            [∵ [tex]6C_{5} =6[/tex]]

⇒ [tex]0.3811[/tex] ≈ [tex]0.4000[/tex]

Hence we can conclude that the probability that the Islanders will win at least five out of six games in a series against the Rangers is 0.4.

Learn more about probability here

https://brainly.com/question/10377907

#SPJ3

1. Find the AREA of the circle.

Answers

Answer:

Step-by-step explanation:

If you leave π as π, it should be 169π square feet

If you do π as 3.14, it should be 530.66 square feet.

If you do π as 22/7, it should be 531 1/7 square feet.

Hope that helps! :)

Ishmael's stock went up $17 on Thursday and then down $13 on Friday. What was the total change in the value of the stock?.

Answers

Answer:is that subtraction?

Step-by-step explanation:

Hi there, please help:)

Answers

Answer:

1/5

Step-by-step explanation:

go up one unit from point (0,1) then go 5 units to the right until you reach point (5,2)

Is the following relation a function? Please help

Answers

No because if you do the vertical line test, it will go through two parts of the circle instead of one.

Answer:

No it is not a function.

Step-by-step explanation:

It goes through 2 points not 1.

Samuel saved some money for a new phone, but then he spent $24 of his savings on a
pair of headphones. Now he has $189 left. Let d be the number of dollars Samuel had
originally saved. Write and solve an equation to find d.

Answers

Answer:

213$

Step-by-step explanation:

24$ on headphones

189$ left

so you add the use and what is left an u get 213$ do not forget to write $ when u are finished :)

What is the domain and range topic is (parabola)

Answers

Step-by-step explanation:

domain is all real positive numbers. x> 0

range is y>= -1

What is the value of x in the figure?
60°
(2x)

Answers

Answer:

The term X is a variable that takes the place of any number. ... Similarly 2 multiplied by X results to X plus X which means a number added to itself since multiplication is a repeated addition. So 2X = 2 * X = X + X = 2X.

Step-by-step explanation:

can i have brainliest

Answer:

x=30

Step-by-step explanation:

Since both of the acute angles have around or similar degrees, they will be the same. But even without that information we can see that each of the angles look the same. We already know that there are 360° in a circle, making 180° in a semi-circle. We can add 60+60 which will give us 120°. 360-120=240, which dividing that by 2 will give us 120, and if we were figuring out the other 2 would be 120° each.

232.7449 rounded to the nearest whole number? please help​

Answers

Answer:

233

Step-by-step explanation:

Look at the tenths place. It is above 5 so you round to 233,

Answer:

233

Step-by-step explanation:

Simple, 7 is closer to 10 than 0, round up to 233.

Select the correct answer.
If the graph of f(x) = 4x is shifted 7 units to the left, then what would be the equation of the new graph?
A.
g(x) = 4x + 7
B.
g(x) = 4(x + 7)
C.
g(x) = 4(x − 7)

Answers

Answer:

g(x) = 4(x + 7)

Step-by-step explanation:

i had this on a test i just took so it told me it was right bit if it is not i am sorry and i will recheck

It would be B because when a graph is shifted left, it would be positive on the inside of the parenthesis. If it was shifting to the right, it would be negative

Plz help ASAP just say give me the answer and the number the answer goes in thank you very much

Answers

Answer:

1) 85

2) 95

3) 75

4) 90

5) 120

6) 110

7) 65

8) 130

FREE PTS! Who is your favorite character? (can be fictional or a real person)​

Answers

Answer:

Yay!!!! Ty for the points!!!!!!!!!!!

I don't have a fav character....I luv BTS - they r real!!!

My mom, she’s a sweetie! So sweet :)

Tansy has 4 different pieces of fruit in a bag . She pulls the pieces out one at a time. In how many different orders could tansy pull the fruit out of the bag

Answers

Answer:

24

Step-by-step explanation:

4!

! represents multiplying all the numbers behind

4*3*2*1=24

10th grade level LT1

Answers

Don’t think anyone will do this for 5 points.

Answer:

36

AE / AD = AB / AC

51 / 51 + 17 = x / x + 12

51 / 68 = x / x + 12

51 ( x + 12) = 68x (After cross multiplication)

51x + 612 = 68x

612 = 68x - 51x

612 = 17x

x = 612/17 = 36

[tex]\mathtt{: )}[/tex]

The mean of data set A is 42. The mean of data set B is 47. The mean absolute deviation (MAD) of both data sets is 2.5. What is the difference of the means?

Answers

Answer:

the difference of the mean in the case of mean absolute deviation is 2.5

Step-by-step explanation:

The computation of the difference of the mean is shown below:

Difference is of

= B - A

= 47 - 42

= 5

Now the difference of the mean is

= 5 ÷ 2.5

= 2.5

Hence, the difference of the mean in the case of mean absolute deviation is 2.5

The same would be relevant

When a positive number is added to its square, the sum is 240. Find the number,

Answers

Answer:

15

Step-by-step explanation:

Good luck

Claudia works at a sweet shop making chocolate-dipped bananas. Sometimes she drops the chocolate-
dipped bananas before she can get them to the freezer. Claudia earns 20 cents for every frozen banana that
she makes. She loses 5 cents for each frozen banana that she drops. Last Wednesday, Claudia dipped 48
frozen bananas, but not all of them made it to the freezer. She earned a total of $7.60. How many bananas
were dropped and how many made it to the freezer? Define your variables and write a system of
equations representing this situation. Solve the system by using either graphing, substitution, or
elimination.

Answers

Here is the work i did for it!

Salma made 378 for 18 hours of work.
At the same rate, how much would she make for 5 hours of work?
Please help me answer this question!

Answers

Answer:

Sorry, I can't help you with that :( I hope someone else can tho!

Step-by-step explanation:

A scientist uses 8.5 grams of carbon every 30 minutes during an experiment. If the experiment lasted 2 hours, how many total kilograms of carbon did they use?

Answers

Answer:

34

Step-by-step explanation:

Answer this please i am stuck

Answers

Answer:

adasdasdadsads

Step-by-step explanation:

Answer:

its impossible

Step-by-step explanation:

Emerson has some yellow stickers and some green stickers. She
has 30 green stickers and the ratio of vellow stickers to green
stickers is 2.5. How many yellow stickers does Emerson have?

Answers

answer:

12

explanation:


the ratio is 2:5 so we know that for every 5 green stickers, Emerson has 2 yellow stickers.

So, we know that 5 goes into 30 6 times so all you have to do is 6 x 2 = 12
Other Questions
Find the sum of 6x2 1 and x + 9. When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough? What are the five ways fossils can form Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Classify the real number.[tex] \sqrt{15} [/tex] Please help! Thank you! Choose one piece of art shown in the unit. In about two paragraphs, create an art critique for this piece of art.A Mesopotamian votive dog statuetteTemple of Ramses IIThe Palette of NarmerA sunk relief image of Pharaoh Akhenaten, Nefertiti, and their children.The Great Sphinx of Gizaif you are confused on how to see the pictures, copy and paste the words in the search bar and it will show you the picture. Brainiest for the best answer! The image below shows anti-Castro forces launching an attack during the Bay of Pigs invasion in 1961. What type of response does this image illustrate? Diplomacy Isolation Intervention Trade Help me please! I will mark brainliest for whoever gets it right the fastest. HELP mE need math help 20 points no links or imma report HeLP mE 1) Drop the er/ir2) Add the ending based on the subjectWrite the correct forms of the given verbs3. leer: to readTCarmenElena y AnaJuanTina y yo4. beber: to drinkToms y RicoElla y yoAna MarlaLas estudiantesLa nia5. abrir: to ooentTTaniaAntonio y LuisaLa profesoraEllos Find the area of the white region in the diagram shown. Mason wants to play with Maliyah's Doll House, but first he needs to stop at the clubhouse. If allthree stops are in the shape of a triangle, which of the following distances would NOT be an option? Which of the following is a true statement about ecology?Ecology is the study of relationships of living organisms and their environment.Ecology is the study how animals adapt to their environment.Ecology studies how living organisms have changed over time.Ecology studies the difference between living organisms. How do friends and peers impact on your sexuality The sum of three consecutive integers is -27 what is the product of the smallest and largest of the three integers? what is the mRNA in TACCGGATGCCAGATCAAATC? pinocchio says my nose will grow. will it grow or not?dun dun dun what is (-10,10) if i dilate it by 1/2 a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius.