Topic: Grammar
Progress
Que:
The movement of the progress bar may be uneven because questions can be worth more or less (including zero) depending on your answer
Read this sentence.
Liza bakes four dozen chocolate cookies each year for the bake sale.
Which of the following answers shows the subject and main verb in this sentence?
O subject: dozen; verb: four
O subject: cookies, verb: chocolate
O subject: year: verb: sale
subiect Liza: verb: bakes

Topic: GrammarProgressQue:The Movement Of The Progress Bar May Be Uneven Because Questions Can Be Worth

Answers

Answer 1

Answer:

subject: Liza, Verb: bakes

Explanation:

a verb is an action someone is doing, and the subject is who is doing that action. Liza Bakes, so Liza is the subject and the thing that she does is bakes.

Answer 2

Subject: Liza; Verb: bakes. Therefore, option (D) is correct.

What is a verb?

In a sentence, an action or state of being can be communicated through the use of a word known as a verb. Because it gives the most important details about what is being said or depicted, it is frequently regarded as the most important component of a phrase or clause. When referring to the time at which an action took place, verbs can be expressed in a variety of tenses, including the present, the past, or the future.

In addition, verbs can be classified as transitive or intransitive, based on whether or not the action they describe requires the participation of an object. It's also possible for verbs to be regular or irregular, and this distinction is based on whether or not they follow a typical pattern of inflection. Verbs, in general, are extremely important tools for conveying meaning and constructing sentences that are comprehensible and efficient.

Learn more about verb, here:

https://brainly.com/question/30515563

#SPJ7


Related Questions

Try These out and I’ll give you brainliest no links posted on My question or I will report you

Answers

Answer:

Ok this isnt a link

Explanation:

Answer: I attached the answers as an image. Hope this helps haha

Put the poem how to eat a poem into a summary in your own words

Answers

Answer:

The poet compares a poem to a fruit to show that a poem is meant to be savoured fully, like a fruit. When she says "bite in," she means it as an invitation to the reader to taste and enjoy the poem. Just as the fruit is rich in juice, the poem is similarly rich in meaning.

Explanation:

Activity 2. Use the correct preposition from the list below.
of, into, to, by, over, on

The evolution (1).......
electronic computers (2)..........a period (3).......time
can be traced effectively (4)...........
dividing this period (5)........
various generations. Each
generation is characterized (6)........
a major technological development that fundamentally changed
the way computers operated. These helped to develop smaller, cheaper, powerful, efficient and reliable devices.
Now you could read about each generation and the developments that led (7)...
.... the current devices
that we use today. Classification (8)... ...... the electronic computers may be based (9)..........
either their principles (10).........
operation or their configuration. By configuration, we mean the size,
speed (11)..........
doing computation and storage capacity (12).........
a computer.

Answers

Answer:

1. Of

2. Over

3. Of

4. By

5. Into

6. By

7. To

8. Of

9. On

10. Of

11. Of

12. Of

Explanation:

A preposition can be defined as a word that shows or illustrates the relationship between a pronoun or noun and other words in a sentence. Some examples of a preposition used in various literary works in English language are up, below, after, by, against, for, over, at, to, etc.

The main purpose of a preposition as a part of speech is to introduce an object (of, upon), indicate a timeframe (from, by, over), show direction (to, across, along), location or place (at, up, after, below) and to illustrate the spatial or sequential relationship between two or more things, people, place, etc.

Which sentence is conditional?
O If you are hungry, eat a piece of fruit.
O Don't eat candy because it isn't good for you. O Please don't eat so many potato chips.
O It isn't healthy to eat so much cake.​

Answers

Answer:A

100% correct

1. state any two qualities of a sentence.

2. What is the difference between a sentence fragment and a run - on - sentence? ​

Answers

Answer:

1. It starts with the main point and easy to understand

2. just another term for 'incomplete sentence. ' Sentence fragments usually lack either main verb or subject (or both). ... Run-on sentences consist of at least two independent clauses that are connected in one sentence without proper punctuation.

Explanation:

Because Alicia forgot her racket at home, she wasn't able to practice with the rest of the tennis team.


How is the underlined linking word used in this sentence?

choices- a. signal additional information
B. to indicate time or sequence
C. to illustrate a comparison
D. to show cause and effect

Answers

Answer:

the answer is D

Explanation:

This sentence has some mistakes in capitalization, punctuation, and use of adjectives. Select each word or group of words that has a mistake.

the excited students entered the cave dark and looked Around. Smart two students saw some crayfish.

Answers

Answer:"the" should be capitalized

Explanation:

Answer:

around shouldnt be in caps

answers:the around cave dark

name some rhetorical devices used in Emersons "Self Reliance"

Answers

Allegory. Nature.

Theme. The need for each individual to avoid conformity and false consistency, and follow their own instincts and ideas.

Metaphor. "The eye was placed where one ray should fall, that it might testify of that particular ray.

Allusion.

Point of View.

Simile.

Imagery.

Irony.

Answer:

Allegory. Nature.

Theme. The need for each individual to avoid conformity and false consistency, and follow their own instincts and ideas.

Metaphor. "The eye was placed where one ray should fall, that it might testify of that particular ray.

Allusion.

Point of View.

Simile.

Imagery.

Irony.

Explanation:


true or false: An adjective is a word that
describes a noun.

Answers

Answer:

DJECTIVE: Describes a noun or pronoun

Explanation:

That is true hope I helped

Student E made the claim, “The legal driving age in the U.S. should be 18 years old.” Which of the following is an example of an appropriate counterclaim the student might make?

Select one:

Many people feel that there should be an upper age limit for driving: elders over the age of 80 tend to lose the mental capacity to safely drive a vehicle.


It might appear as if cars are well-made and are thus safe to drive.


It is often supposed that smoking inhibits a teenager’s mental senses.


Many people argue that teenagers are developmental capable of driving by 16, or even younger.

Answers

Answer:

4. fourth one

Explanation:

Answer:

n

Explanation:

PLZ DO NOT INSERT LINK OR IMAGE ONLY ANSWER

Which of the following is an example of hyperbole?

A tyrannosaurus let out a tremendous roar that shook the ground.
The movie theater was silent, dark and empty.
You never let me leave the house, Mom!
There are no zombies under your bed, now go to sleep!

Answers

Answer:

"you never let me leave the house, mom!"

Explanation:

Answer:

im pretty sure its c) You never let me leave the house, Mom!

a hyperbole is an exaggeration and "never" is the key word here.

its not a because its possible for sound to shake structures, there is no exaggeration

its not b because its just describing the setting, there is no exaggeration

it is not d because its just a reassuring statement, there is no exaggeration

Explanation:

i hope this helped :)

10.) Jasmine's grandma knits very good.
Grammar answer

Answers

Answer:

Jasmine's grandma knits very well.

Explanation:

Good sounds wrong in the phase but saying well sounds more fluent. Sorry if it's wrong. I just answered it how I would say it to a English teacher.

Someone please help and I will mark you as brainlist!!

10) There is an empty lot between the river and ___

We or us?

11) the newly elected class president is “she”

Is “she”

• nominative case
• objective case
• possessive case


12) the committee ____ several issues among themselves.

Is discussing or are discussing?


13) the man, “whom” you met at the office, is my best friend.

Is “whom”

• nominative case
• objective case
• possessive case


14) I don’t even know __ she is

Whom or who?


15) either Tom or Susan __ on the next street?

Live or lives?

Answers

Answer:

10) us

11) nominative case

12) are discussing

13) objective case

14) who

15) lives

Answer:

us

nominative case

are discussing

objective case

who

lives

no links
pppppppppppppppppppppppppppppppppllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllllzzzzzzzzzzzzzzzzzzzzzzzz help

Answers

Answer:

Symbols, Imagery, and figurative language

Explanation:

dose some one know what's the squar root of 81???

Answers

Answer:

9

Explanation:

9 times 9 is 81

Answer:

9

Checking Work: [tex]9^{2}[/tex] = 81

Question 13 of 20
In civil rights literature, which ideology was often at odds with
multiculturalism?
A. Self-determination
B. Abolition
C. Disillusionment
D. Disenfranchisement

Answers

Answer:self determination

Explanation:

Valley forge: would do you have quit?

Q: how could this document be used to argue for quitting

Answers

DONT OPEN THE FILE PLEASE DO NOT

yo watz up yall i need help ;)

Answers

Answer: SIKEEEEEEEEEEEEEEEEEEEEEEEEEEEE

Explanation:

(1) In 1751, the Philadelphia Provincial Assembly had a bell made. (2) It was for the new State House. (3) The bell weighed more than 2,000 pounds. (4) The bell was 12 feet in circumference around the bottom. (5) It came to be known as the Liberty Bell because it was inscribed with a motto about liberty. (6) Unfortunately, the Liberty Bell cracked in 1752 during a test ring. (7) To fix the bell, the Philadelphia Assembly had it recast. (8) Some people say the bell cracked again in 1835. (9) It was tolling for John Marshall’s funeral. (10) However, that is probably just a legend. (11) It is a fact that on February 22, 1846, the bell cracked again. (12) That crack could not be fixed. (13) The Liberty Bell has had a crack in it ever since. Which is the most effective way to combine sentences 8 and 9?

A.Some people say the bell cracked again in 1835 while it was tolling for John Marshall’s funeral.
B, Cracked again in 1835, some people say while tolling for John Marshall’s funeral.
C. Some people say the bell cracked again in 1835 and was tolling for John Marshall’s funeral.
D. Although some people say the bell cracked again in 1835, it was tolling for John Marshall’s funeral.

Answers

Most people frown about #4. It is a comma splice which means that 2 main clauses hung together by a comma. The better way to do it is with a ; since the two statements are unrelated. In this case it is a very fine point of grammar which is more annoying than wrong.

#1 is wrong because there is no main clause. The bell is the beginning of the main clause.

#2 is passive. It's not wrong, but the writing style could be better.

#3 <<<< answer The and is the proper way to connect 2 predicates.

If you can give me brainliest than that will be amazing. Thank You!

CASE Grade 8 Language Arts
Read the excerpt from paragraph 12.
"Must I submit to be carried along with the current..."
What is the meaning of the metaphor?

Answers

Answer:

the meaning of this metaphor is To become excited about something or determined to do something.

Why does the author provide foreshadowing in this excerpt?
A: To indicate that the Duende is evil.
B: To indicate that the Duende eats too much.
C: To indicate that Juanito will be in danger.
D: To indicate that Juanito needs more tortillas.

Answers

I think it’s C sorry if it’s wrong. Hope i helped:)

What is the main purpose of this article? a. To inform people of precautions to take against the plague c. To talk about cures for the plague b. To inform people about a historically important plague d. To tell how friars dealt with the plague.

Answers

Answer:

B, to inform people about a historically important plauge.

Explanation:

Got it right on edge.

Is it

A.
B.
C.
D.

plsssssssssssssssssssssss help

Answers

Answer:

A.

Explanation:

what finally convinces Jeannette that she must leave , and that she must do so herself

Answers

Answer:

who the hell is jeannette

Explanation:

Who is that? Like how are you going to put a name and not explain

How did Jim Crow affect life in Montgomery?

Answers

Starting the Montgomery Bus Boycott. the Supreme Court after 381 days finally listed segregation on public buses unconstitutional. "the Montgomery Bus Boycott helped eliminate early barriers to transportation access."

Which one is right grammatically:

Every player should feel proud of (his/their) team.

Answers

Answer:

their?

Explanation:

According to Paul, grace is
a. Earned
b. Worked for
c. Freely given
d. A reward

Answers

Answer:

My friend also did this, she said its A. that what she said. so i dont know but i hope this helped.

Explanation:

A or B this question is a bit hard but its A or b

In one paragraph, using your own words, define the term observations, describe two different types of observations, and explain how observations can be helpful in a discussion.

Answers

Answer:

leave the door opennnnn

Which sentence correctly uses a colon to introduce a quote?
Select one:

Veterinarian Cindy Frost, a dog-lover: People with dogs “are simply happier.”

Veterinarian Cindy Frost is a dog-lover, who reminds us that: people with dogs are simply happier.

Veterinarian Cindy Frost discusses being a dog-lover: “People with dogs are simply happier.”

Veterinarian Cindy Frost discusses: being a dog-lover, “People with dogs are simply happier.”

Answers

Answer:

the third sentence uses colon to separate the quote.

The lion was roaring loudly. The lion jumped into the air to chase its prey.

Which revision uses a participial phrase to combine these two sentences correctly?

As the lion was roaring loudly, it jumped into the air to chase its prey.
Roaring loudly, the lion jumped into the air to chase its prey.
The lion was roaring loudly and jumped up to chase its prey.
When the lion jumped in the air to chase its prey, it was roaring loudly.

will give branlist pls

Answers

Answer:

Roaring loudly, the lion jumped into the air to chase its prey.

Explanation:

Other Questions
What are the five ways fossils can form Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Classify the real number.[tex] \sqrt{15} [/tex] Please help! Thank you! Choose one piece of art shown in the unit. In about two paragraphs, create an art critique for this piece of art.A Mesopotamian votive dog statuetteTemple of Ramses IIThe Palette of NarmerA sunk relief image of Pharaoh Akhenaten, Nefertiti, and their children.The Great Sphinx of Gizaif you are confused on how to see the pictures, copy and paste the words in the search bar and it will show you the picture. Brainiest for the best answer! The image below shows anti-Castro forces launching an attack during the Bay of Pigs invasion in 1961. What type of response does this image illustrate? Diplomacy Isolation Intervention Trade Help me please! I will mark brainliest for whoever gets it right the fastest. HELP mE need math help 20 points no links or imma report HeLP mE 1) Drop the er/ir2) Add the ending based on the subjectWrite the correct forms of the given verbs3. leer: to readTCarmenElena y AnaJuanTina y yo4. beber: to drinkToms y RicoElla y yoAna MarlaLas estudiantesLa nia5. abrir: to ooentTTaniaAntonio y LuisaLa profesoraEllos Find the area of the white region in the diagram shown. Mason wants to play with Maliyah's Doll House, but first he needs to stop at the clubhouse. If allthree stops are in the shape of a triangle, which of the following distances would NOT be an option? Which of the following is a true statement about ecology?Ecology is the study of relationships of living organisms and their environment.Ecology is the study how animals adapt to their environment.Ecology studies how living organisms have changed over time.Ecology studies the difference between living organisms. How do friends and peers impact on your sexuality The sum of three consecutive integers is -27 what is the product of the smallest and largest of the three integers? what is the mRNA in TACCGGATGCCAGATCAAATC? pinocchio says my nose will grow. will it grow or not?dun dun dun what is (-10,10) if i dilate it by 1/2 a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well.