StudySprint
Home
Search
Login
Search
Home
Law
The Process Shown In This Diagram Affected Which Outcome?
Law
College
The process shown in this diagram affected which outcome?
Answers
Answer 1
Answer:
The rights of states to accept or reject federal laws.
Explanation:
Related Questions
Other Questions
Otto invests $ 600 in an account that pays 7.3 % interest compounded annually. How much is in Otto's account after 3 years
What is the definition of 'gist'?The facts used by the author to make a point.The main point or essence.The transitions between paragraphs.The conclusion of an article
A rental car company charges $80 per day to rent a car and $0.10 for every mile driven. Alyssa wants to rent a car, knowing that: She plans to drive 150 miles. She has at most $300 to spend. Which inequality can be used to determine xx, the maximum number of days Alyssa can afford to rent for while staying within her budget?Geq30080x+15300 15x+80\leq30015x+80300 80x+15\leq30080x+15300 15x+80\geq30015x+80300
Consider Hermia's first words when she enters the scene. How do her comments about the setting relate to the action of the scene? In particular, how might Shakespeare intend a double meaning here for her use of the word "sense"?
A woman sold an article for 20.00cedis and made a profit of 25%.Find the cost price of the article.
What is the sign of -9. (0/-3)
When evaluated, which expression has a result that is a rational number?
The angle of elevation to a nearby tree from a point on the ground is measured to be31. How tall is the tree if the point on the ground is 62 feet from the tree? Roundyour answer to the nearest tenth of a foot if necessary.
Lighting is the movement of?
A business manager finds that the building expense each month is completely uncorrelated with revenue levels. What should the business manager assume about this cost?
What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2
HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience.
From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance.
Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place.
Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3]
HELP ASAP 30 POINTS WORTH !!!!! OO The slope of a line is 2. The y-intercept of the line is 6. Which statements accurately describe how to graph the function? Locate the ordered pair (0, 6). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (0, 6). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points.
Please help!!!hi,can you please help me with this?thanks
can someone answer this please
one of the main ways that federal and state courts differ is the process of discovery that is required in each court. true or false?
What is the reporters motive in article 1?What is the reporters motive in article 2?Which term from Senator Nelsons quote in article 2 is an example of bias?