The key to identifying a Combustion reaction is

Answers

Answer 1

Answer:

Good signs that you're dealing with a combustion reaction include the presence of oxygen as a reactant and carbon dioxide, water, and heat as products. Inorganic combustion reactions might not form all of those products but remain recognizable by the reaction of oxygen.


Related Questions

Which statement BEST expresses the idea that emotions are like a GPS system?

Answers

Answer:

Where's the full question?

Explanation:

Which type of macromolecules helps a cell brake down food? Lipids proteins carbonhydrates or nucliec acids

Answers

Answer:

Proteins

Explanation:

There are four major biomolecules found in living system namely; proteins, carbohydrates, lipids and nucleic acids. These biomolecules serve different and unique functions in the body. PROTEIN is a biomolecule that helps in the break down of food substances in the body as stated in this question.

Specifically, these function of breaking down food substances is carried out by ENZYMES, which are biological catalysts that are proteinous in nature i.e. structurally made of proteins. For example, amylase enzyme breaks down starch, lipases break down lipids. Hence, since enzymes that perform this disintegration function are PROTEINOUS, then PROTEINS are the biomolecules that perform the role.

2. Which contains the other, cell membrane or phospholipid?

Answers

Answer:

Cell membrane contains phospholipid

Explanation:

Part of the cell membrane is made up of the phospholipid bilayer, which consists of two layers of phospholipids.

are plasmids plant,animal or bacteria cell?

Answers

Answer:

Bacteria

Explanation:

A plasmid is a small, often circular DNA molecule found in bacteria and other cells. Plasmids are separate from the bacterial chromosome and replicate independently of it. They generally carry only a small number of genes, notably some associated with antibiotic resistance.

Plant, Animal and Bacterial Cells: Comparisons
Plant Cell Animals Cell Bacterial Cell
Present Present Absent
Plasmids
Absent Absent Present
Plastids
32 more rows•

HELP PLZZ?!
What is a region called that is characterized by things like abiotic factors and plant life?
biome
biosphere
ecosystem
estuary

Answers

A) biome.........................

Answer:

Biome

Explanation:

Сотраге and contrast Simple Dominance to Incomplete Dominance."

Answers

Answer:

Simple dominance is when the dominant gene in a heterozygous organism expresses the dominant phenotype. Incomplete dominance is when a heterozygous organism exhibits a blending of both genes, recessive and dominant. Red and white flowers will "blend" and make pink flowers.

Incomplete dominance, only one allele in the genotype is seen in the phenotype. In simple dominance, both alleles in the genotype are seen in the phenotype. In incomplete dominance, a mixture of the alleles in the genotype is seen in the phenotype.

When can a mutation lead to an adaptation?

Answers

Answer:

If the mutation has a deleterious affect on the phenotype of the offspring, the mutation is referred to as a genetic disorder. Alternately, if the mutation has a positive affect on the fitness of the offspring, it is called an adaptation.

Explanation:

Consider a population that contains black and white cats where the black allele (B) is dominant and the white allele (b) is recessive. Indicate whether each statement is true or false.
1. Evolution is occurring in a population of cats where the genotype frequencies of BB, Bb, and bb are 0.64, 0.32, and 0.04, respectively.
2. A population of cats is in Hardy-Weinberg equilibrium when the genotype frequencies of BB, Bb, bb are 0.49, 0.33, and 0.16, respectively.
3. Evolution is occurring in a population of cats where the genotype frequencies of BB and Bb are 0.7 and 0.2, respectively. _____
4. A population of cats is in Hardy-Weinberg equilibrium when the genotype frequencies of BB and Bb are 0.25 and 0.5, respectively. _____

Answers

Answer:

what is this what subject

Question 4 (1 point)
What pattern occurs every 365.26 days on Earth? Choose all correct answers.
Earth rotates around the Sun.

Earth revolves around the Sun.
C с
Earth's degree of axis tilt changes.
d
Earth orbits around the Sun.

Answers

Answer: D

Why? The earth orbits the sun and it does this over the span on 365.26 days

Hope this helps

Two students compare and contrast the composition of a plant and animals cells. Several observations are made during the investigation. Which observation is incorrect?
Plant and animal cell contain cell membranes.
Plant cell are contained within cell walls, while animal cells are not.
Plant and animal cells contain a nucleus.
Plant cell do not have cytoplasm.

Answers

Answer:

I believe the correct answer would be D- Plant cell do not have cytoplasm

Explanation:

Plant and animal cells both have a cytoplasm so D is the incorrect statement.

Two students compare and contrast the composition of a plant and animals cells. Plant cell do not have cytoplasm this observation is incorrect. Therefore, option D is correct.

What is cytoplasm ?

The liquid present inside a cell but not in the nucleus of the cell. In a cell, the cytoplasm is where the majority of chemical processes occur.

The gel-like substance that fills a cell is called cytoplasm. It serves as a catalyst for chemical reactions. It offers a foundation for other organelles to function within the cell. A cell's cytoplasm is where all the processes for cell division, growth, and replication take place.

Rudolf von Kölliker coined the phrase in 1863, first using it as a synonym for protoplasm, but over time it has come to refer to the cell's interior and extracellular organelles.

The first phase of cellular respiration, known as glycolysis, as well as mitosis and meiosis are just a few of the numerous cellular processes that take place in the cytoplasm.

Thus, option D is correct.

To learn more about the cytoplasm, follow the link;

https://brainly.com/question/15417320

#SPJ6


"In rabbits, B = black fur and b = white fur. If fur color is an incomplete dominance trait, what phenotype will a
heterozygous rabbit show?"

Answers

Answer:

b is the answer my friend. hope this will solve your problem. mark me as brainliest

7 reasons plants are important to the environment

Answers

Answer: The House of the Scorpion

Explanation: the first sentence fight for this

I need help with this, thank you

Answers

Answer:

a

Explanation:

the answer is a

universe is biggest and then Galaxy and solar system and then earth

the anwser is a! have a good day!


Which phrases describe the open-ocean zone? Check all that apply.
very little sunlight
Ofew nutrients
low temperatures
low density
located near coasts

Answers

Answer:

Very Little Sunlight

Few Nutrients

Low temperatures

Explanation:

It was correct on the test.

Hello, t8j5gq6rzt! I hope I can answer your question.

The open-ocean zone has low temperatures because there's little sunlight. So you will want to check:

Very little sunlight

Low temperatures

PS. Brainliest would be appreciated. :)

What is the difference between traditional PCR and qPCR?
a. Traditional PCR has only 1 cycle whereas qPCR has multiple cycles
b. In traditional PCR, the presence or absences of a DNA sequence is analyzed upon reaction completion whereas qPCR monitors DNA amplification as the reaction progresses
c. Traditional PCR is an outdated technique which is unreliable and has not been utilized for years whereas qPCR is a newer and better technique which is always preferred nowadays.
d. Traditional PCR is monitored by an increases in fluorescence signal whereas it is impossible to monitor qPCR by increases in fluorescence signal

Answers

Answer:

The difference between traditional PCR and qPCR (Real-time PCR) is:

b. In traditional PCR, the presence or absences of a DNA sequence is analyzed upon reaction completion whereas qPCR monitors DNA amplification as the reaction progresses

Explanation:

Real-time PCR (qPCR) is an advanced tool for analyzing RNA and DNA.  With Traditional PCR detection occurs at the end-point of the reaction, while with Real-time PCR, detection of the RNA and DNA sequencing is detected as the reaction is occurring.  The advantages of the qPCR over the traditional PCR include higher precision and resolution,  and increased dynamic range and sensitivity.

Polymerase Chain Reaction (PCR) is a widely-used Biology tool to rapidly replicate millions of copies of a specific DNA sample.

Two hawk species are present in the same ecosystem. Hawk A feeds on mice and squirrels, both of which feed on seeds and nuts. The small population of Hawk species B eats snakes that feed on mice and squirrels. Which describes why Hawk B is the keystone species in this scenario?

Answers

Answer:

Hawk B species help other populations survive by keeping snake predation low.

Complete question and Explanation:

Due to technical problems, you will find the complete question and the explanation in the attached files.

An idea based on observations with no experimental evidence is a:
a.
Hypothesis
c.
Theory
b.
Model
d.
Law


Please select the best answer from the choices provided

A
B
C
D

Answers

Answer:

a

Explanation:

The answer is A, a hypothesis

How is the energy of chemical processes coupled in metabolic pathways?

Answers

Answer:

Energetic coupling of chemical processes in metabolic pathways Biochemical systems couple energetically unfavorable reactions with energetically favorable reactions. These reactions can be part of catabolic pathways where complex substances are broken into simpler ones with the release of energy or anabolic pathways where complex molecules are synthesized with an input of energy.

Explanation:

Down syndrome in humans is due to ________ of the 21 st chromosome.

Answers

Answer:

Down syndrome in humans is due to ADDITIONAL, PARTIAL OR FULL COPY of the 21 st chromosome.

Explanation:

Down syndrome is a genetic disorder in which an individual has a total of 47 chromosomes instead of 46 that is, 23 pairs of chromosomes which is found in normal individuals. This occurs as a result of the presence of additional, partial or full copy of chromosome 21. There are generic variations that occurs in chromosome 21 leading to down syndrome, these include:

-->Trisomy 21 : the individual has three copies of chromosome 21 instead of two copies due to abnormal cell division that occurred during development of sperm or egg.

--> Mosaic Down syndrome: the individual has some cells with an extra copy of chromosome 21 and it's caused by abnormal cell division after fertilization.

--> Translocation down syndrome: This type of down syndrome occurs when chromosome 21 gets attached to another chromosome which occurs during or after conception.

Generally the symptoms due to the presence of this extra genetic material includes:

--> short heights

--> poor muscle development

--> short neck

--> short fingers with small hands and feet

--> increased risk to development of dementia

--> greater tendency to develop obesity

what is the role of PCR in DNA typing

Answers

Answer:

Polymerase chain reaction, or PCR, is a laboratory technique used to make multiple copies of a segment of DNA. PCR is very precise and can be used to amplify, or copy, a specific DNA target from a mixture of DNA molecules.

Explanation:

PCR is used in molecular biology to make many copies of (amplify) small sections of DNA? or a gene?. Using PCR it is possible to generate thousands to millions of copies of a particular section of DNA from a very small amount of DNA. PCR is a common tool used in medical and biological research labs.

In bacterial communities, where resources are often limited, survival requires the ability to sense, respond to, and cooperate or compete with neighboring organisms.

a. True
b. False

Answers

Answer:

Explanation:

True.

In bacterial communities, where resources are often limited, survival requires the ability to sense, respond to, and cooperate or compete with neighboring organisms is a true statement.

What are Bacterial communities?

Bacterial communities differ in their species makeup, the niches they occupy, and the effects they have on various ecosystems.

Communities defy a single, fundamental definition due to their complexity. Instead, they offer fascinating illustrations of dynamic processes that vary with ecological size. In the beginning of microbiology, there were difficulties in describing and classifying communities.

Robert Koch revolutionized the study of microbiology in the late 1800s by inventing his techniques for proving the link between an infection and an organism (Koch, 1876). Koch's hypotheses continue to be the "gold standard" for linking germs to illness or any other interesting event.

Therefore, In bacterial communities, where resources are often limited, survival requires the ability to sense, respond to, and cooperate or compete with neighboring organisms is a true statement.

To learn more about bacteria, refer to the link:
https://brainly.com/question/8008968

#SPJ5

Which of the following virulence factors would most likely produce an organism that can hide within the host cell,
growing intracellularly?
A)invasins (Type 3 secretion system)
B)capsule
C)IgA protease
D)Opa protein

Answers

The best answer to go with is b

A mountain range known as the Southern Alps runs through the center of the South Island. What type
of mountains do you think the Southern Alps are?

Answers

Answer:

fold mountains

Explanation:

The Southern Alps are a 300-mile- (480-km-) long chain of fold mountains containing New Zealand's highest

Convert the DNA strand to mRna, then use the codon chart to translate the codons into amino acids.
DNA → TAC CAT GGA ATT ACT

mRNA →

Amino acids →

I NEED HELP PLEASE

Answers

Answer:

DNA → TAC CAT GGA ATT ACT

mRNA: AUG GUA CCU UAA UGA

Amino acids: met-val-pro-stop

Explanation:

Which is NOT a similar function of all cells?
photosynthesis
reproduction
absorption of nutrients
growth

Answers

Answer:

A is the answer hope it helps

Technology affects the environment in many ways. Which negative impact is NOT due to advances in technology?
A) toxic waste
B) global warming
C) habitat destruction
D) increase in natural disasters

Answers

Answer:

d

Explanation:

Im pretty sure that the answer is d because how could technology cause more NATURAL disasters and also i took the USATestprep

 

Which is a characteristic of arthropod?

A. moist skin
B. feathers
C. scales
D. joint-legged​

Answers

Answer:

D joint legged like butterfly

Answer:

D.joint legged

Explanation:

D.joint legged

By the end of the Jurassic Period, the Sundance Sea was filled up with sediments and formed a swampy lowland known as

Morrison Foredeep
Panthalassa Moor
Franciscan Terrane
Great Black Swamp
Solenhofen Swamp

Answers

Answer:

Morrison Foredeep

Explanation:

Morrison Foredeep is a swampy lowland formed due to filling of Sundance Sea  with sediments during Jurassic period. Series of sedimentary rocks deposited during the Jurassic Period in the western North America, from Montana to New Mexico. Morrison Formation is famous for the presence of  dinosaur fossils, which have been collected since 1877 about more than a century ago beginning with a find near the town of Morrison, Colorado.

which action is most likely to keep succession going and make an ecosystem more stable?

Answers

Answer:

c

Explanation:

When both lactose and glucose are available to E. coli, which part of the lac operon regulation assures that glucose will be metabolized first? When both lactose and glucose are available to E. coli, which part of the lac operon regulation assures that glucose will be metabolized first? Permease allows lactose to enter the cell when lactose enters the cell. The repressor binds to the operator in the absence of lactose. The repressor cannot bind to the operator in the presence of lactose. RNA polymerase transcribes the lac operon to make a single RNA molecule. CAP binds to cAMP and then to the promoter only in the presence of low glucose.

Answers

Answer:

CAP binds to cAMP and then to the promoter only in the absence of low glucose

Explanation:

When both lactose and glucose are available to E. coli, the part of the lac operon regulation that assures that glucose will be metabolized first is

CAP binds to cAMP and then to the promoter only in the absence of low glucose

Lactose is a type of sugar that is found naturally in milk produced by mammals and Glucose is a monosaccharide made mostly by plants during photosynthesis

Other Questions
Why should police be able to use peoples DNA without consent? NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) What is Isolated system Which describes the translation of ABCD to A'B'C'D'.A)translation 3 units right and 6 units uptranslation 6 units right and 3 units uptranslation 3 units left and 6 units downD)translation 6 units left and 3 units down Read the sentences.I want to be in London right now. I really want to see Big Ben and Buckingham Palace.Which sentence uses the subjunctive mood to express the ideas in the sentences?Going to London to see Big Ben and Buckingham Palace is a dream of mine.Going to London to see Big Ben and Buckingham Palace is a dream of mine. , ,I will go to London right now, and I will see Big Ben and Buckingham Palace.I will go to London right now, and I will see Big Ben and Buckingham Palace. , ,If I can get to London, I will see Big Ben and Buckingham Palace.If I can get to London, I will see Big Ben and Buckingham Palace. , ,If I were in London right now, I would go see Big Ben and Buckingham Palace.If I were in London right now, I would go see Big Ben and Buckingham Palace. , , Find the x and y intercept of this equation: -2x + 8y =4 write your solutions as a point in the form (x,y) How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air Can I have some help with this math? Pls hurry, I will mark brainliest Evaluate the expression 4 25 . A human resources manager selected a random sample of 200 workers who donate to charity. The following table shows the distribution of the 200 workers. Count Type of worker Management Other white collar 96 50 S Blue collar 54 The manager conducts a goodness-of-fit test to determine whether the proportions of workers of these types are identical to the population proportions of workers donating to charity, which are 50 percent for management, 30 percent for other white-collar workers, and 20 percent for blue-collar workers. Which of the following statements must be true about the sample?A. The expected number of blue-collar workers donating to charity is less than 30. B. The expected number of management workers donating to charity is 100. C. The expected numbers of other white collar and blue-collar workers donating to charity are the same. D. The expected number of other white-collar workers donating to charity is 50 E. The combined expected numbers of other white collar and blue-collar workers donating to charity is greater than the expected number of management workers donating to charity. I have to find the missing angles In what Century did people learn how traits pass from one living being to itsdescendants? Find the sum or typeimpossible"Help Resources[1 -2 1] + [4 -5 -6]Skip[[?]Enter Texas Roadhouse opened a new restaurant in October. During its first three months of operation, the restaurant sold gift cards in various amounts totaling $1,800. The cards are redeemable for meals within one year of the purchase date. Gift cards totaling $728 were presented for redemption during the first three months of operation prior to year-end on December 31. The sales tax rate on restaurant sales is 4%, assessed at the time meals (not gift cards) are purchased. Texas Roadhouse will remit sales taxes in January.Required:a. Record (in summary form) the S3,500 in gift cards sold (keeping in mind that, in actuality, the firm would record each sale of a gift card individually). b. Record the S728 in gift cards redeemed. c. Determine the balance in the Deferred Revenue account (remaining liability for gift cards). HEY CAN SOMEONE HELP ME WITH MY LASTEST MATH QUESTION I WILL GIVE BRAINLIST PLEASE :))) Mongar Corporation applies manufacturing overhead to products on the basis of standard machine-hours. Budgeted and actual overhead costs for the most recent month appear below: Original Budget Actual Costs Variable overhead costs: Supplies $7,980 $8,230 Indirect labor 29,820 29,610 Total variable manufacturing overhead cost $37,800 $37,840The original budget was based on 4,200 machine-hours. The company actually worked 4,350 machine-hours during the month and the standard hours allowed for the actual output were 4,190 machine-hours. What was the overall variable overhead efficiency variance for the month?a. $130 Unfavorableb. $950 Favorablec. $1,440 Unfavorabled. $1,310 Favorable