Spring and Fall
To a Young Child
by Gerard Manley Hopkins

Márgarét, áre you gríeving
Over Goldengrove unleaving?
Leáves like the things of man, you
With your fresh thoughts care for, can you?
Ah! ás the heart grows older
It will come to such sights colder
By and by, nor spare a sigh
Though worlds of wanwood leafmeal lie;
And yet you wíll weep and know why.
Now no matter, child, the name:
Sórrow’s spríngs áre the same.
Nor mouth had, no nor mind, expressed
What heart heard of, ghost guessed:
It ís the blight man was born for,
It is Margaret you mourn for.

What do the falling leaves represent in "Spring and Fall"?

the heart that grows colder as years go by

the sadness felt by young people

the inevitability of aging and death

the process of learning and growing

Answers

Answer 1

Answer: The inevitabillity of aging and death

Hope it helps

Answer 2

Answer: The inevitabillity of aging and death

Explanation:


Related Questions

Define the concepts study plan and state Three ways in which you could use it to study effectively​

Answers

Answer:

Time management is very important. Everyone gets 24 hours . It's not like that I get 26 hours or you get 22 hours . Manage your time .

Explanation:

Lol got this from this app

hope it helps btw

What is the tone of poem The Hill We Climb by Amanda Gorman??

Answers

Answer:

The tone of this poem is amusing on the whole. However, the tones used by Amanda’s mother and by Amanda herself are vastly different. Amanda’s mother is authoritative and strict. On the other hand, Amanda is dreamy and childish. The clash between them is what provides amusement for readers.

Answer:

The tone of the poem, however, suggests that light, "dawn," is indeed there to be found: the American nation is "unfinished" but not defeated.

Explanation:

I hope this helps in anyway

What word is an adverb in the following sentence: He is widely regarded as one of the greatest writers.

Answers

Answer:

"widely"

Explanation:

Hi there,

An easy way to identify most adverbs is to see whether the word ends with

"-ly". The adverb for this sentence is the word "widely".

Cheers.

Which sentence below is a "run-on sentence?

The field is too wet and soggy the soccer team's game will be rescheduled.

Tina's pants are too long they
will have to be hemmed by a tailor.

The crowd went wild when Jake hit the ball out the park and ran the bases to home
plate.

The bird flew around the yard, squawked at our family eating on the deck, and dove at
the dog

Answers

Answer:

I believe its c

Explanation:

what kind of personal information should i post online​

Answers

Answer:

None.

Explanation:

Your nick name, age range, and/or country / state

Not actual name, phone number, email, family members name, address, passwords, anything that you pay annually.

That's the main part of it at least.

Which contains a spelling error? A) One of the performers in the show did a fantastic dance routine. B) The worst act in the show was the comedian who told foolish jokes. C) The best performence of the night was the choir that sang patriotic songs. Eliminate D) The passengers on the bus were treated to a really great show from the choir.

Answers

Answer:

C

Explanation:

Performance with an a after the m, not an e.

what is the important of the institutional hymn?​

Answers

A place of graduation hymn isn't simply any common melody it is the authority "song of devotion" of an instructive organization. A school must have a place of graduation hymn it gives a feeling of having a place, comradeship, pride and dependability to the school.It recognizes the school and its understudies.

What is the idea behind creating Hymn to the Nile?

The peculiarity that the Hymn to the Nile answers the reliance of the Egyptian individuals on the Nile waterway. The text shows that the Nile waterway filled in as a wellspring of life which supported and gave all to Egyptians "who makes generally that is great"

Hymn to The Nile is a tune that was made and sung by the old Egyptian people groups about the flooding of the Nile River and every one of the marvels it brought to Ancient Egyptian human advancement. Since the antiquated Egyptians had depended on this wonder waterway, Egypt was the "Endowment of the Nile."

For more information about Hymn, refer the following link:

https://brainly.com/question/5488568

Who was Gatsby waiting for while he was in the bushes? O Daisy Nick The dog Tom​

Answers

Answer:Gatsby was waiting by the bushes

Explanation:

To make sure Tom does not hurt Daisy over being mad about the accident

She looks at her watch and said, "It's time to go to bed
". Which of the following words from the sente
e sound?
C. time
bed
D. watch​

Answers

The sente of sound is D.Watch

Which of these statements demonstrates an example of irony/satire?
es
0)

Answers

D is the correct answer

statement on D is the one which demostrate an example of irony/satire

In the end, does Austen seem to favor sense or sensibility as a character trait? Explain your answer with a close analysis of the text. Your answer should be at least 100 words.

Answers

Answer:

In the end, it seems to me that Austen favored sense. Sense even used in diabolical ways such as Lucy's seduction of Richard and betrayal of Edward brings about the outcome of choice.   Elinor's sense is more realistic than Marianne's sensibility. Although Jane Austen's is sure to show the benefits of passion,  Elinor's reason contrasts Marianne's sensibility throughout. Austin is sure to point out the downfalls of sensibility. At the end of this novel,  Marianne's idealism is guided by sense. She has grown up and now sees the prudence of using reason to temper passion. Austen artfully brings the two narratives together in the conclusion.

Explanation:

Select the phrase that uses capitalization correctly B. a document called The Bill Of Rights 0 A. a book called Harry Potter And The Sorcerer's Stone O C. a song called "My Heart Will Go on" D. a movie called The Bride of Frankenste Click to select your answer.​

Answers

Answer:

D

Explanation:

The others capitalization is wrong

Which option is an example of literal language?
Select one: NO LINKS PLZ

The bird’s song was a sermon.

The bird’s song was colorful.

The bird’s song was beautiful.

The bird’s song was poetry.

Answers

The birds song was beautiful

Answer:

The bird’s song was beautiful.

Explanation:

1984: Which of the following inferences is best supported by the description of the diary Winston has bought?

a) The diary once belonged to Party members to keep notes on the citizens.

b) Winston thinks that it looks so beautiful because it is an object from a past he can barely remember.

c) Winston likes it because he had a diary just like it when he was growing up.

d) Winston has purchased it in order to sketch his own drawing of Big Brother’s face.

Answers

Answer:

b

Explanation:

took the quiz

anyone here watches AOT?​

Answers

I did a while ago, I still haven’t watched the new season but I have seen many spoilers so I know what happens basically

Answer:

OMG YESSS i finished season 4 all ep IT WAS SO GOOD AHHH ALSO gonna read the manga soon so excited!!

explanation: love show!! eren ❤️

8 Put can, can't, must or mustn't in the blanks.
k.
1.
m.
Yes, you
finish
Rosy Mum! Can I watch TV for some time?
Mum. You
finish your homework first!
RosyOh, Mum!
I go to Aunt Rita's house, please?
Mum
But you
your homework before you go. And you
call me when you reach her house.
Rosy : OK, Mum. Can I stay there tonight?
Mum : No, you
come home
at six o'clock.
Rosy
OK, Mum
I go now?
Mum Wait! It's cold outside. You
forget your
jacket!
You
Now sit in pairs and practise the conversation above​

Answers

Answer:

Explanation:

Yes, you  

finish

Rosy Mum! Can I watch TV for some time?

Mum. You

finish your homework first!

Rosy Oh, Mum!

cant.t I go to Aunt Rita's house, please?

Mum

But you must do

your homework before you go. And you must  call me when you reach her house.

Rosy : OK, Mum. Can I stay there tonight?

Mum : No, you must come home  at six o'clock.  Rosy

OK, Mum

can I go now?

Mum Wait! It's cold outside. You mustn't

forget your

jacket!

Read the following sentence and decide if it is compound or complex. Then,
choose the answer that correctly identifies the sentence classification and
gives one reason why you know this classification is correct.
When my mother and I went shopping, we had a lot of fun trying on ridiculous
outfits and laughing at ourselves.
A. Compound; the sentence contains at least one dependent clause.
B. Complex; the sentence could be broken into two main clauses.
C. Complex; the sentence contains a subordinating conjunction.
D. Compound; the sentence contains a coordinating conjunction.

Answers

Answer:

it's option is C.

Explanation:

Complex the sentence contains a subordinating conjunction

please follow me if it is correct

pls anwer this pls real answer pls​

Answers

1) The grasshopper dances and hops during the whole day.
2) The ant works hard to save food.
3) Today it rained.
4) The grasshopper is out of food.
5) The grasshopper decides having food is necessary for rainy days.

When people are infected with influenza virus, they...

A. Experience uncomfortable symptoms as their body fights the virus.

B. Might feel worse depending on how much exposure they’ve had to the virus.

C. Can combat the virus by immediately getting a vaccination.

D. Will start to feel better when their body begins fighting the infection.

Will give brainliest...

Answers

Answer: Experience uncomfortable symptoms as their body fights the virus.

Explanation:

I did the test.

Select the correct answer from the drop-down menus.
Read the excerpts. Then choose the correct way to complete the sentence.
The Supreme Court decision
the Fifteenth Amendment by stating that

Answers

Answer:

The Supreme Court decision approved the Fifteenth Amendment, stating that any citizen could vote regardless of color, race, or history of servitude.

Explanation:

The texts show that the American Supreme Court decided to approve suffrage for blacks, that is, the Supreme Court decided that it was illegal to prohibit blacks, who were now free citizens, from voting. This gave rise to the fifteenth amendment that declared that every American citizen could vote, regardless of their color, race, or history of servitude.

This moment is reinforced in the second text, where the supreme court prohibits Texas from preventing blacks from voting, saying that this attitude is unconstitutional.

Answer:

"clarifies" and “This grant to the people of the opportunity for choice is not to be nullified by a state."

Explanation:

it was right on plato. i hope this helps :))

Read the paragraph below from the article.
If you watch a cat or dog sleeping, you might see them flick an ear or grunt or twitch while sound asleep. And yes, they likely are dreaming. Scientists think that all mammals and birds dream, but fish, reptiles and insects don't. By looking at the brain patterns of sleeping animals, they think animals dream about chasing, pouncing and finding their way home — rehearsing important skills.
Which statement summarizes the paragraph?
A
Scientists who study animals have found that mammals and birds dream while they sleep.
B
Scientists who study animals are not sure what cats and dogs dream about.
C
Scientists who study animals have found that fish and reptiles dream more than people do.
D
Scientists who study animals want to do more work to find out about animal dreams.

Answers

Answer:

A. Scientists who study animals have found that mammals and birds dream while they sleep.

Explanation:

It won't be B because the scientist have a good idea on what cat and dogs dream about.

It won't be C because the paragraph says that fish and reptiles don't dream.

It won't be D because they already have a good idea on what animals dream about.

That leaves A to be the correct answer in my opinion.

Hope this helps ^-^

Underline the correct form of the verbs in the brackets below.

Malaysia is a country which (1) (has,have) many popular holiday spots known for their natural beauty. To meet the increasing demand for suitable places to hold company functions and seminars, Indah Hotels and Resorts Sdn. Bhd. (2) (offers,offer) three hotels. They (3) (are,is) located on the islands of Penang, Langkawi and Tioman. The Indah Langkawi Beach Resort is located in Burau Bay Langkawi. Covering an area of 50
acres, it (4) (starts, started) operations in July last year. The 400-room resort has a fully
equipped convention centre. Facilities for meeting (5) (includes, include) eight seminar rooms. The hotel also (6) (provides, provide) a wide range of recreational facilities.
On the east coast of Peninsular Malaysia (7) (is, are) the tropical island of Tioman. The Indah
Tioman Resort (8) (is, are) the island's only international standard resort. In December, 1995, the resort (9) (receives,received) an award for the best managed resort in Malaysia. The hotel guests (10) (stay, stayed) in "Kampung' style chalet. They (11) (are,were) very popular with foreigners.
The third Indah Beach Resort (12) (opened, will open) its doors to the public in June next year. It (13) (will offer,offer) facilities such as golf and snorkelling. For company functions, a large
hall and two other meeting rooms (14) (are, will be) available.The Indah Group of hotels offers the best at very reasonable rates. So, why (15) (don't,doesn't) you plan your next meeting, seminar or even holiday at one of our hotels.​

Answers

Explanation:

1. has

2. offers

3.are

4.started

5.includes

6.provides

7.is

8.is

9.received

10.stay

11.are

12.will open

13.will offer

14.will be

15.don't

if your friend tell you they want to become a electrician. HOW COULD YOU REPLY BACK​

Answers

Answer:

I would say "good job, best of luck to be an electrician, if you need any help, I would surely help you!"

the epiphany that john has toward the end of the final paragraph ("...for was it not he, in his false pride and his evil imagination, who was filthy?") is a moment in which

Answers

Answer:

his judgment of himself as well as of others leads him to feel intense guilt

Explanation:

Seven through sixteen

Answers

Answer:

7. smell, i smell more plants. sight, i see a lot of bugs. hear, i hear animals. touch, i feel the grass. taste, i taste easter candy.

8. a change i could make in the beginning of spring would be to go outside more

9. sorry id k this one

10. if i could plant a garden of anything it would be herbs so that i could have them fresh for cooking

11. leaves

12. sorry id k this one

13. no

14. warm, breezy, full of bugs, colorful

15. the zoo

16. yes

Explanation:

sorry that i didnt know how to answer two of them

What is this part of the passage mostly about? A. Lily worked with her father to make many mugs with the same shape. B. Lily needed to find a big factory that would make her mug from her. C. Lily got the idea from her father to sell a lot of different mugs. D. Lily tried many different ways to make the best mug for the factory mold.

Answers

Answer:

A. Making mugs with the same shape

B. Lilly needs to find a mug making factory

C. Lilly got the idea to sell different mugs

D. Lilly tried different ways to make the best mug

Answer:

lily tried many different ways to make the best mug for the factory mold.

Time flies
Voice stops echoing in my head...
And I start Brusting in the paper....
Tears flows
Heart calms
In the moment I sit down to write

I go to my own created fantasy world
I get my wings back
I get my real life back.....

I cry...
I laugh...
I play...
But only with my words...

I can be my own real self
I can be the one I always wanted to be.....

In the moment I sit down to write​

Answers

Answer:

nyc but what is the question?

Explanation:

Which sentence contains error-free spelling?

Answers

Answer: C. Bill said that he wants to work with the United States government when he finishes school.

Explanation: The other answer choices spell government wrong.

Answer:

C

Explanation:

Government is spelled government

Helppppp plsssssssssssssssssssssss thanks




ฅ^•ﻌ•^ฅʕ•ᴥ•ʔʕ•ᴥ•ʔ

Answers

Answer:

A

Explanation:

it suits the question the most because the mother reacted to quangs answer in a negative way

I think the answer is B

worth 25 points!!
Why should someone read the text These supper clubs are using food to cross cultural divides. write a short response using r.a.c.e and t.a.g

Answers

Answer:

no

Explanation:

ehhshshsjshsjsjsjsjsjsjsjs

Other Questions
Michael bought three baseballs from a sports store. Each baseball cost the same amount. The total cost was $8.37. If C represents the cost of each baseball, which of the following statements are true? Select all that applyThe value of c can be found using the formula 30+837The value of c can be found using the formula C/8.37 = 3Each baseball cost $25.11Each boseball cost $279 Need help ASAP giving away 15 points will mark brainlyist as well Why are waterways in the UnitedStates so important to human settlement andeconomic activity? A democracy that adopts simple plurality or first past the post electoral rules is likely to have a Group of answer choicesTwo-Party System.Multi-Party System.One Party System. A phase change is when a substance changes from one state of mind to nother because of the adding or removal of thermal energyTrueFalse pleaase help withhh tthis used to have a square garage with 296 ft of floor space. recently built an addition to it. The garage is still a square, but now it has 50% more floor space. What was the length of one side of the garage originally? What is the length of one side of the garage now? What was the percent increase in the length of one side? Please Answer! I will give brainiest. The Picture is down below :)Thank You! EXERCISE 1 IMAGINE YOU ARE A CHILD AT SCHOOL .WRITE A DIARY ENTRY IN ABOUT 150-200 WORDS ABOUT YOUR EMOTIONS THE DAY BEFORE YOUR SCHOOL TAKES YOU TO A THEME PARK Please answer these questions and I swear I will give you brainlist I promise I will answer this question part a and part b please What is the length of the missing leg?45 and 36 Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) What is Isolated system How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air