Some relationships between organisms are described below. What type of relationship does each statement describe?

Answers

Answer 1

Answer:

Competition, predation, commensalism, mutualism and parasitism.

Explanation:

There are five types of relationships present between organisms such as competition, predation, commensalism, mutualism and parasitism. Competition is a type of interaction between organisms in which both the organisms are harmed. In predation relationship, one organism feed on the other by killing it. commensalism is a relationship in which one is benefited and the other is neither benefited nor harmed. In mutualism relationship, both the organisms or species gets benefit from one another whereas parasitism is a type of relationship in which one organism is benefited and the other is harmed not killed.


Related Questions

Need help, I will give branliest

Answers

Answer:

Supergiants

Explanation:

Which type of human population is characterized by the lag phase, being able to raise crops and domesticated animals, but having over farming methods that lead to soil eorion and food shortages?

Answers

Answer:

Rural population.

Explanation:

The rural population of humans is characterized by the lag phase because they are linked with farming of crops and domesticated animals. This population is responsible for the soil erosion and food shortages over the country because they are the producers of everything for the food industry. Due to farming methods, soil erosion occurs that leads to the depletion of nutritive part of the soil that causes less productivity of the crop and as a result food shortage occur.

I NEED HELP ASAPPP PLEASE
C. When the arm extends (straightens), which muscle contracts?

Answers

Explanation:

When your biceps muscle in your upper arm contracts, it pulls your lower arm in towards your shoulder. However, when it relaxes, your biceps cannot push your arm back out. To do this, your triceps muscle, on the underside of your upper arm, contracts and straightens your arm out.

Answer:

When your biceps muscle in your higher arm contracts, it pulls your lower arm in to your shoulder. when it relaxes, your biceps cant push your arm back out.  and straightens your arm out.

Explanation:

Explain how a school bus uses all of these energy types.

-Mechanical
-Chemical
-Electrical
-Thermal

Answers

Answer:

thermal

Explanation:

the use of fuel, the fuel move and convert to fire by the help of the plug which put a spark to mix with the fuel to enable movement

Answer:

electrónico como comutadora

Observing Animals (Image Attached)
Let’s study and compare three animals: a frog, an ancient and extinct mammal-like animal, and an owl. Observe the illustrations, and then answer the questions.

1. How are the bodies of the three animals similar to one another? How are they different?

2. What might these similarities suggest about the common ancestor of these organisms?

Answers

Answer: They each have patches on their stomachs. Also, all 3 animals have claws or legs, even though they play different function in each organism, they 3 still share the same characteristics of having claws or legs.

Explanation:

I am also trying to understand the 2nd question, but this is the answer to the 1st one.

Arturo ran a 3,000-meter race. His running time from start to finish was 10 minutes. What was Arturo's average speed?

Answers

Answer:

300 meters/min

Explanation:

average speed = distance / time

(3000 m) / (10 min) = 300 meter per minute

if you need it in meters/sec then just multiply 10 by 60 first and then continue

(3000 m) / (600 sec) = 5 m/s

PLSSS HELP IMMEDIATELY!!!!! i need help rn!! only help if u know, i’ll give brainiest if u don’t leave a link

Answers

Answer:

Its keen eye sight helps it to see prey from the sky

Explanation:

Second option, doesn't make sense because their white and brown feathers aren't used for camoflouge  

Third option, bald eagles fly not swim

Fourth option, bald eagles use their beaks for critical tasks, such as building nests, catching food and preening.

What type of microscope would you use to view a live sample?
1. Scanning Electron Microscope
2.Transmission Electron Microscope
3.Magnifying glass
4. Light Microscope

Answers

Answer:

Compound microscopes

Compound microscopes are light illuminated. The image seen with this type of microscope is two dimensional. This microscope is the most commonly used. You can view individual cells, even living ones.

Some flowers show incomplete dominance. If RR = white and R'R' = red, which phenotypic ratio would
be expected in the o spring of two pink flowers?

Answers

Answer:

1 red: 2 pink: 1 white

0 red: 4 pink: 0 white would be the phenotypic ratio expected in the o spring of two pink flowers. So, the correct option is (D).

What is Phenotypic ratio?

Phenotypic ratio defined as the relative number of offspring expressing a particular trait or combination of traits, which can be determined by performing a test cross and the frequency of the trait or trait combinations being expressed depending on the genotype of the offspring can be identified.

Phenotypic ratio is expressed as the ratio of different phenotypes present in the progeny of a cross where the ratios are numerical comparisons. For example, if one has three mangoes and two oranges, the ratio of mangoes to oranges will be 3:2.

For above given information, if we cross RR which is white with R'R' which is red, we will get 4RR' offspring which are pink in color. then the ratio will be 0 red: 4 pink: 0 white.

Thus, 0 red: 4 pink: 0 white would be the phenotypic ratio expected in the o spring of two pink flowers. So, the correct option is (D).

Learn more about Phenotypic ratio, here:

https://brainly.com/question/11552649

#SPJ6

A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include

Answers

Answer:  Identify the promoter and the stop signal (terminator).

Explanation:

DNA is a molecule that contains the genetic information in all living things. This information is used for the synthesis of proteins that make up the body and carry out vital functions of the organism.

The DNA molecule consists of two strands that wind around each other to form a double helix structure, where each strand has a central part formed by sugars (deoxyribose in the case of DNA) and phosphate groups. The four basic components of DNA are nucleotides: adenine (A), thymine (T), guanine (G) and cytosine (C). The nucleotides are joined together (A to T and G to C) by chemical bonds and form base pairs that connect the two strands of DNA. Depending on the sequence of nucleotides (which have different bases), different proteins are synthesized.

DNA replication consists of synthesizing another identical DNA molecule, using enzymes called polymerases, which are molecules specifically dedicated only to copy DNA. Transcription, on the other hand, is the process by which a copy of messenger RNA (mRNA) is generated from the sequence of a gene in the DNA. This RNA molecule leaves the cell nucleus and enters the cytoplasm, where it directs protein synthesis (a polymer made up of many amino acids).

Protein synthesis, or translation, involves translating the sequence of an mRNA molecule into an amino acid sequence during protein synthesis. The genetic code describes the relationship between the sequence of base pairs in a gene and the corresponding sequence of amino acids it encodes. To begin translation, a start codon (set of 3 bases) must first be identified, which is usually AUG that also codes for the amino acid methionine. Then, the codons that follow are read and the corresponding amino acids are added according to the genetic code. The transfer RNA (tRNA) is complementary to the anticodon at specific codons in the messenger RNA and carries the amino acid coding for the codon. In addition, ribosomal RNA (rRNA) is an RNA that is part of ribosomes and is essential for protein synthesis in all living things. rRNAs form the framework of ribosomes and associate with specific proteins to form ribosomal pre-subunits. To finish the translation, a termination codon has to be read, which can be UGA, UAG or UAA.

To revise the model to show transcription to form mRNA, the research should identify the promoter and the stop signal. The promoter is a DNA sequence required to turn a gene on or off. The transcription process starts at the promoter which is usually located near the beginning of a gene and has a binding site for the enzyme that is used to make a messenger RNA (mRNA) molecule. The enzyme RNA polymerase will keep doing the transcription until it reaches a sequence of DNA that is signal which indicates it should stop. This process is called termination, and it happens once the enzyme reaches this sequence, called terminator.

Why is the success of a mutation dependent on environmental conditions?


PLEASE HELP QUICK!!!

Answers

the mutation can only be passed down in the environment is in the favor of the gene (natural selection)

ex. dark haired mice only surviving on dark lava rock while the white mice on the dark lava rock are getting killed.

Can someone plz help

Answers

The answer to your question is the first one
A. The passage of genetic instructions for one generation to the next

Humans, and other animals, exhale
A. oxygen

B. natural gas

C. carbon dioxide

D. cytoplasm

Answers

Answer:

C

Explanation:

Humans,and other animals,exhale carbon dioxide and inhale oxygen.

Answer:

c: humand and animals exhale carbon dioxide

The San Andreas Fault marks the boundary between which two tectonic plates?

Answers

Answer:

The San Andreas Fault is the transform plate boundary where a thin sliver of western California, as part of the Pacific Plate, slides north-northwestward past the rest of North America

A population of lowers is separated by an eight-lane superhighwax, Pollen is often camed by the
and across the highway and can pollinate the flowers on the other side of the highway Can speciation

occur in this situanon2
No because the populations are not reproductively isolated
Ne because the populanons are not geographically isolated
Ces because the populations are reproductively isolated
Yes because the populations are geographically isolated
DONE
Fr

Answers

Answer:

hi

Explanation:

Answer: A) No, because the populations are not reproductively isolated.

Explanation:   :)

PLEASE HELP 5TH GRADE SCIENCEEEE AHHHHHHHHH PLEASE HELP ME IM GONNA FAIL IF I DONT GET THIS Alanna spots a bird in her back yard. The bird is sitting on a tree. Explain how the outer coverings of the bird and tree are different and have different functions.

Answers

Answer:

The purpose of the outer covering of the bird helps keep it warm and to help it fly, whilst the outer cover of the tree is to protect it from bugs. 

Explanation:

Answer: Bird: helps protect it from the environment. Tree: To help reduce water loss.

Explanation:

The outer covering of the bird helps protect it from cold weather, while the outer covering of the tree helps it to reduce water loss.

Please give it a 5 star!

Do you think aluminum foil is a good insulator or conductor? Why? Give data ( I'm talking about numbers here)

Answers

Answer: hewo, There! your Answer is Below ;w;

aluminum foil reflects the emission of heat, it tends to be a better insulator than other materials that just slow down the flow of heat from one area to another. So It is a Good Insulator,

Explanation:

aluminum foil is a good insulator because it prevents the radiation of heat by reflecting it back at the source.

Hope this helps!

Have a great day!!!

-August-

A man has Huntington's disease (a dominant trait) and a heterozygous genotype. He has four children with a woman who does not have Huntington's disease. What are the odds their children will inherit Huntington's disease?

Answers

Answer:

50/50

Explanation:

please help me with my science will give brainlest help asap 2 question, please dont answer just for points :(

Answers

Answer:

1. 50cm

2. Direct

Explanation:

1. The distance pulled back means you get your answer from the distance pulled back data. Since 50cm is the largest of your given data, that makes the cart go farthest.

2. The farther you pull the band back, the farther the cart will go. Since both increase when you increase the distance you pull the band back, this is a direct relationship.

At high altitudes, air is less dense than at sea level because of decreased air pressure. This means that a person who ascends to high altitudes takes in fewer oxygen molecules per breath. Describe and explain an immediate response that occurs in the circulatory system when a person first reaches high altitudes. Use vocabulary from class.

Answers

An immediate response that occurs in the circulatory system when a person first reaches high altitudes is that the heart beats faster to meet the demand for oxygen that the body needs.

What are the main effects of altitude?

The higher it is, the worse the symptoms, which include

headacheshortness of breathrapid heartbeatamong others

Not everyone has these symptoms when they go to high-altitude places, but it is also not possible to know who will or will not feel something.

With this information, we can conclude that An immediate response that occurs in the circulatory system when a person first reaches high altitudes is that the heart beats faster to meet the demand for oxygen that the body needs.

Learn more about high-altitude in brainly.com/question/14756132

#SPJ2

Which of these mammals are native to Virginia

Armadillo

Camel

Kangaroo

Squirrel
(Don’t leave links)

Answers

Answer:

Right a way, we know that a camel or a kangaroo are NOT native to Virginia. Now we have the armadillo and the squirrel.

"Originally native to South America, the armadillo now ranges as far north as Texas, Oklahoma, Kansas, Louisiana and Florida." - so we can rule out armadillos!

Virginia has 4 different kinds of squirrels that are native, so squirrel would be your answer.

Hoped this helps!

What is the mrna sequce of the T T C A A T G G T C T A G G G

Answers

Answer:

AAGTTACCAGATCCC

Explanation:

always remember, you would just switch them, The Opposite Of T is A and The Opposite of G is C,  and vise versa.

Which does NOT define a situation as a crisis?

a.The situation creates a hardship.
b.You don't have the resources needed to deal with the situation.
c.You feel overwhelmed or helpless to handle the situation.
d.The situation is annoying because it causes you to not have something that you want.

Answers

A. The situation creates a hardship.

meaning of cell or cytology​

Answers

Answer:

the smallest structural and functional unit of an organism, typically microscopic and consisting of cytoplasm and a nucleus enclosed in a membrane.

Explanation:

Cell is the building blocks of life.

Proteins and polysaccharides are polymers. These polymers are formed by dehydration synthesis. Which statement correctly identifies a difference in the structure of proteins and polysaccharides? *
A. forming a variety of gametes that will pass on hereditary information

B. disrupting meiosis and the synthesis of amino acids into a sequence

C. producing the inorganic molecules needed for normal cell growth

D. directing the synthesis of proteins necessary for proper cell function

Answers

D. directing the synthesis of proteins necessary for proper cell function

I hope this helps a little.

Rain forests supply a wide variety of resources. Some of
these resources include rubber, bamboo, coconut oil, and
medicines. The map shows where Earth's tropical rain
forests are found.
Rainforests
Northern
hamisphere
Southern
hemisphere
Equator
Based on the map shown above, which statement is most accurate?
O A. Most rain forests are found near the equator.
O B. Rainforests are found all over Earth,
O C. Rainforests are no longer found on Earth.
O D. Most rain forests are found near the North and South poles.

Answers

Answer:

Explanation:

I would say A

Answer:

O A. Most rain forests are found near the equator.

Explanation:

Which problem do you think contributes most to water scarcity?

Answers

Answer:

QUESTION:

Which problem do you think contributes most to water scarcity?

ANSWER:

Water shortages may be caused by climate change, such as altered weather patterns including droughts or floods, increased pollution, and increased human demand and overuse of water. A water crisis is a situation where the available potable, unpolluted water within a region is less than that region's demand.

Explanation:

Hope that this helps you out! :)          

If you have any questions please put them in the comment section below this answer.          

Have a great rest of your day/night!          

Please thank me on my profile if this answer has helped you.  

HELP PLEASE I WILL GIVE YOU THE BRAINLIEST

Answers

Answer: the answer should be C)Modles can not account for ever factor that may suddenly  change.

<sorry if it’s wrong>

2. Describe the info flow of transcription. (A. DNA --> DNA / B. DNA -> RNA / C. RNA --> protein / D.
DNA --> protein)
3. Describe the info flow of translation. (A. DNA -> DNA / B. DNA -> RNA / C. RNA --> protein / D. DNA-
-> protein)
4. Describe the info flow of expression. (A. DNA --> DNA/B. DNA --> RNA / C. RNA --> protein / D. DNA
--> protein)
5. Describe the info flow of replication. (A. DNA --> DNA/B. DNA --> RNA / C. RNA --> protein / D. DNA-
-> protein)

Answers

Answer:

I think the dna is like in the butt but I really have no key to my hose

Explanation:

jsnfjfnf

Whenever energy appears in one system,
A.
it must have come from somewhere else.
B.
it means the system is suitable for creating energy.
C.
it must be used quickly or it will be permanently lost.
D.
it means energy creation has outpaced energy destruction.

Answers

Answer:

it must have come from somewhere else.

Explanation:

I did it on studyisland

Other Questions
1.00 x 10^8 kg of clear liquid (specific heatcapacity = 5.11 x 10^2 J/kgC) at a temperatureof 15.0C gains 3.33 x 10^6 J of heat. What is thefinal temperature of the liquid? (Assume themelting point is less than 15.0C and the boilingpoint is greater than 62.0C.) Roger made a table showing how he spent his time in one day. How many dayswill go by before Roger has slept the equivalent of one day. Explain how you found your answer!Data:work : 1/3 daysleep : 3/8 daymeals: 1/8 daycomputer : 1/6 day Type the correct answer in the box. The area of the figure is square units. Which two consecutive integers does -138 lie between?A:11 and 12B:12 and 13C:-11 and -12D:-12 and -13 How many grams of 02 will be consumed?23.36 g 0211.68 g 02 Help PlsIts a math question, see attachments Which expression is equivalent to \left(3^{-6}\times 3^{3}\right)^{-1}\normalsize?(3 6 3 3 ) 1 ? 3^{-19}3 19 3^{18}3 18 3^{-3}3 3 3^{3}3 3 Will give brainlest if correct, and 5 stars.Solve for x hellooo everyone !!! I'm an Indian !!!! Nice to meet y'all which of the following angles would a director most likely use to film the weak underdog in a movie? Find the volume of the composite solid. Round your answer to the nearest tenth.PLEASE HURRY!!! A composite solid is shown with a cube placed at the bottom and a half-sphere placed at the top of the edges of the upper plane surface. The length, width, and height of the cube are 8 centimeters respectively. when was happened the colonization of east africa? write and solve a real world problem that can be solved using the greatest common factor of two numbers How was the first World War the result of changes that occurred in the long nineteenth century? How might Fascism have manifested (become apart of) everyday life in Italy? how can the conductivity of a semiconductor be increased? How does O'Brien's courage fail him around Linda? O A. He can't bring himself to think about her. O B. He can't bring himself to talk to her. O C. He can't bring himself to ask her out. O D. He can't bring himself to listen to her. A 400g pack of couscous contains 116g of carbohydrate.A 250g bag of maize flour contains 195g of carbohydrate.A 1kg bag of wheat flour contains 640g of carbohydrate.Use percentages to work out the amount of carbohydrates in each. If 10.0 J of work are required to transfer 2.00 coulombs ofcharge from point X to point Y in an electric field, what is thedifference in potential between these two points? What was the result of the plan for Quebec to separate from Canada?