A 400g pack of couscous contains 116g of carbohydrate.
A 250g bag of maize flour contains 195g of carbohydrate.
A 1kg bag of wheat flour contains 640g of carbohydrate.
Use percentages to work out the amount of carbohydrates in each.​

Answers

Answer 1

Answer:

A: 70%   B: 64%

Step-by-step explanation:


Related Questions

I need help with this question

Answers

Answer:

2n=12

Step-by-step explanation:

The next step would be to subtract four from each side getting 2n=12 or B

32 is 4 more than twice a
number. What is the number?

Answers

Answer:

The number you are looking for is 14.

Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800?

Answers

Answer:

6.5%

Step-by-step explanation:

I just know

HELP I MARK BRAIN thing

Answers

Answer:

It would be A. x < 6

Step-by-step explanation:

The number line shows it is less than six with a closed circle and the arrow pointing towards the left of it

3-108. Write an equation and find the answer for each of the following problems. Give answers in decimal form. Homework Help a. What is the product of three tenths and four hundredths?​

Answers

product means multiply, so 3/10 * 4/100 = 12/1000, simplified is 6/500

What is the value of 4^3

Answers

Answer:

the answer is 64

Step-by-step explanation:

becasue 4 time 4 is 16 and 16 times 4 is 64. You have to multiply 4 against itself 3 times.

Answer:

64

Step-by-step explanation:

4³ = 4 · 4 · 4 = 64

solve the triangle give the measure of angle G

Answers

Answer:

G = 46 degrees

Step-by-step explanation:

Here, we want to find the measure of angle G

Mathematically, as we can see, what we have is a right triangle

For a right triangle , the sum of angles is 90 degrees

Thus, if we add the two internal angles, we get 90 degrees

Hence;

44 + G = 90

G = 90-44

G = 46 degrees

Using the formula below, calculate the z-score for the listed data points. z-score: zx = x − μ σ z1 = z5 = z6.5 =

Answers

Answer:

z1 = -1.95

z5 = 0.05

z6.5 = 0.8

Step-by-step explanation:

The value of the z score for a mean of 4 and standard deviation is 1.

What is Z score?

The z score is used to determine by how many standard deviations the raw score is above or below the mean. It is given by:

z = (x - μ)/σ

Where x is the raw score, μ is the mean and σ is the standard deviation.

Let us assume that μ = 4, σ = 2, hence for x = 6:

z = (6 - 4) / 2 = 1

The value of the z score for a mean of 4 and standard deviation is 1.

Find out more on Z score at: https://brainly.com/question/25638875

1. Whats the exact value of Y?
2. Whats the exact value of X?

Answers

Answer:

Hello! The answer is in this link.

Step-by-step explanation:

8518-06-04-10-15-instructional.mp4. I hope this helps! Have a great rest of your day!

The company charges $45 a day for the car
as well as charging a one-time $25 fee for
the car’s navigation system (GPS). Write an
equation for the cost in dollars, C, as a
function of the number of days, d, the car
was rented.

Answers

Answer:

I personally find it easier to put my equation in words before actually writing the equation, so for this particular situation, the equation would sound like this :

→ The cost (C) is equal to 45$ a day (d) plus 25$!

Now that your equation is put into words, all that you have to do is write down the equation without the words :

→ C = (45d) + 25

If you want to make sure that your equation is correct, you can try it out, say for instance you want to rent a car for a week, so for a total of 7 days, and you want to see how much it would cost :

d = 7 (in this particular situation)

C = (45 × 7) +25

C = 315 + 25

C = 340

→ So it would cost 340$ to rent a car for a week!

credit goes to naomi479xx for solving this answer.

Rebecca wants to prove that if the diagonals in parallelogram are perpendicular, then it is a rhombus. Select the appropriate rephrased statement for Rebecca's proof

Answers

Answer:

The answer is C

Step-by-step explanation:

Khan Academy

Answer:

C

Step-by-step explanation:

SOMEBODY HELP ME PLEASE

Answers

Answer:

90

Step-by-step explanation:

9*6=54

54*5= 270

270/3=90

Can someone please help me answer this question asap thank you . No links please and thank you .

Answers

It’s a 10 to 1 relationship

Based on the data given in the table,
which is a reasonable estimate of
the download time of a 600-kilobyte
A 10 seconds
B 12 seconds
C 15 seconds
D 17 seconds

Answers

Answer:

C. 15 seconds

Step-by-step explanation:

It wouldn't be A, because 10 seconds can download 348 kilobytes, it wouldn't be B too as it would be at about 400+ kilobytes, the only possible answer is 15 seconds as the last option takes 17 seconds for 715 kilobytes.

which graph represents a function

Answers

Answer:

a

Step-by-step explanation:

Answer:

dfvgbhnm,kmjnhbgvx

Step-by-step explanation:

c vgbhjnmk,jnhbgvfc

How many minutes are there in 12.5 hours?

Answers

Answer:

750 minutes

Step-by-step explanation:

Answer:

750 minutes would be your answer

Step-by-step explanation:


At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labour
charge for a 5 hour job?

Answers

445 .                       Answer:

Step-by-step explanation:

445 I think ………………………….

This Question: 1 pt
20 of 20
This Qu
th
The pH of a fruit juice is 2.9. Find the hydronium ion concentration, [H30 * ), of the juice. Use the formula pH = -log[H30*]
The hydronium ion concentration [H30 + ] is approximately moles per liter.
(Use scientific notation. Use the multiplication symbol in the math palette as needed. Round to the nearest tenth as needed.)

Answers

Answer:

scientific" (and any subsequent words) was ignored because we limit queries to 32 words.

Your search - This Question: 1 pt 20 of 20 This Qu th The pH of a fruit juice is 2.9. Find the hydronium ion ... - did not match any documents.

Suggestions:

Make sure that all words are spelled correctly.

Try different keywords.

Try more general keywords.

Try fewer keywords.

Puteti sa ma ajutati va rog

Answers

Answer:

I read the title wrong, please remove my answer

Step-by-step explanation:

Cups by the water cooler are in the shape of a cone. The height is 15 cm and the diameter is 7.6 cm.

What is the volume of one water cooler cup, in cubic centimeters? (Use 3.14 for
π.)

Answers

Answer:

226.7 cm³

Step-by-step explanation:

The cone volume formula is V = (1/3)(base area)(height).

Here that comes out to V = (1/3)(pi)(3.8 cm)^2·15 cm, or 226.7 cm³

Which of the following is a proportion?

Answers

Answer:

the second one

Step-by-step explanation:

A pioneer family travels for 30 hours at maximum speed in a covered wagon. Their neighbor walks 20 hours at a pace of 3 miles per hour. Which group traveled the greater distance?

Answers

If the covered wagon travels faster than a walking pace if 3mph the wagon will travel further.

Please help! Thank you!

Answers

Answer:

X=sigma xi/no of observation

5= (?) /4

5*4=sum of all numbers

20=sum of all the observation

If you are helped by this answer pls tag me brianliest I really want it

THANK YOU.......

Helpppp I need this for rn thank youuuuu❤️

Answers

Answer:

-1,7

0,-3

1,-7

5,47

Step-by-step explanation:

-x-=+

7
-3
-13
-53

This should be right

solve the system by substitution 3x-y=10 2x=y

Answers

Answer

X=10 and y=20

Step-by-step explanation:

since y=2x, you need to substitute that into the equation to get:

3x-(2x)=10

And evaluate:

x=10

Then substitute 10 into the equation: 2x=y:

2(10)=y

evaluate:

20=y

Now go back to the original equation to check your answer and substitute the values in:

3(10)-(20)=10

30-20=10

10=10

X=10, Y=20
steps
1) substitute 2x into the equation for Y
2) combine like terms ( 3x and -2x which equals 1x or x)
3) solve for x’s value (10)
4) plug in x’s value to solve for y
5) plug values into original equation to check work

the area is approximately ___ square ft.

use 3.14 for pi​

Answers

Answer:

200.96

Step-by-step explanation:

divide the diameter by 2, to get 8. then multiply 8 by 8 to get 64. 64×3.14 is 200.96

Mhanifa Plz help me with this thank you!

Answers

Answer:

D

Step-by-step explanation:

This is an example of the Pythagorean theorem.

In triangle BEH, the sum of the squares of the sides of the two smaller sides, BE and BH is equal to the longest side squared, EH.

What is the probability that someone in your class wants the New England Patriots to win

Answers

Answer:

Step-by-step explanation:

It all depends on how many people are in your class.

To calculate probability

Determine a single event with a single outcome.

Identify the total number of outcomes that can occur.

Divide the number of events by the number of possible outcomes.

To determine the probability, Use the formula

What is the formula of probability?

P(A) is the probability of an event “A” n(A) is the number of favourable outcomes. n(S) is the total number of events in the sample space.

P(A | B) = P(A∩B) / P(B)

Rob is saving to buy a new MP3 player. For every $16 he earns babysitting, he saves $9. On Saturday, Rob earned $32 babysitting. How much money did he save?



If he earned $32, he saved $____

Answers

Answer:

18 dollars

Step-by-step explanation:

32÷16=2

9×2=18

Help!!! I do not seem to understand this problem well.

Answers

Step-by-step explanation:

weeks. days. (wk,d)

2. 14. (2,14)

4. 28. (4,28)

6. 42. (6,42)

8. 56. (8,56)

Other Questions
what is the mRNA in TACCGGATGCCAGATCAAATC? Help!!! I do not seem to understand this problem well. Why would an investor want to choose a certificate of deposit over a corporate bond describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans plz no bit.yl stuff, just answers Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?A.It shows that a disease can cause genetic changes.B.It is a reflection of how genetic factors affect health.C.It shows how public health is affected by environmental factors.D.It indicates how a toxin can play a role in the development of disease. why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver I will mark Brainliest for frist answer This Question: 1 pt20 of 20This QuthThe pH of a fruit juice is 2.9. Find the hydronium ion concentration, [H30 * ), of the juice. Use the formula pH = -log[H30*]The hydronium ion concentration [H30 + ] is approximately moles per liter.(Use scientific notation. Use the multiplication symbol in the math palette as needed. Round to the nearest tenth as needed.) A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size When riding your bike on a main road you should always follow the rules of the _________.roadbikers guidewalkerstown they are riding in Can someone please help me on this plz I beg u :( Please real answers. Marking brainliest.How did Gerald Ford become president of the United States?A. He was elected president in a special election.B. He was vice president when the president resigned.C. He was elected president following an election campaign. D. He was appointed by Congress after the president was impeached. Writing: Critique On Nutrition And Pregnancy. Critique a current article or website on Pregnancy and compare to good nutrition practices. 1) Evaluate the recommendations. 2) Compare the recommendations. Write a 300 or more on your findings and conclusions. ( Will Mark Brainliest). Mhanifa Plz help me with this thank you! Need help on doing escape room. How to escape from Emoji Planet. One effect of road, air, and rail transportation in Georgia is that they What is one service the Freedmen's Bureau provided for African Americans?The agency provided funds to pay poll taxes.The agency set up courts to settle land disputes.The agency taught them how to cultivate crops.The agency found employment in Northern cities.