"S PRACTICE Exam#1 68Qs.doc
PII CVS PRACTICE Exam#1 68Qs.doc (69 KB)
Page <
of 8
C
30. The largest cells in the blood that leave the bloodstream to become macrophages are th
A. Neutrophils
B. Eosinophils
C. Lymphocytes
D. Monocytes
21
ruthroblastocie fatalie also

Answers

Answer 1

Your Answer will be D. Monocytes

[tex] \frak{hope \: it \: helps \: you.....}[/tex]

Answer 2

Answer:

The largest cells in the blood that leave the bloodstream to become macrophages are the

Monocycles


Related Questions

Density is mass per unit of volume. Which pair of lab instruments would a student use to measure the density of seawater?

Answers

answer:

a balance and a graduated cylinder

Explanation

Density is mass per unit and it is property characteristic of a substance. The arrangement of the mass of atoms and their size is what determines the the density of a substance.

For a student to measure the density of seawater he/she is required to use a balance and a graduated cylinder where a balance will be used to measure the mass of the mineral sample and then a graduated cylinder to determine the volume.

What is stimulated by high extracellular fluid volume (ECFV) and works to increase GFR and urine output?

Answers

Stretching of the atrial muscle cells releases a hormone called atrial natriuretic factor (ANF). ANF relaxes the juxtaglomerular (JG) cells of the afferent arteriole and thereby increases GFR and urine output.

Fevers (below 102ºF):

a
Damage essential proteins in your body
b
Inhibit the growth of pathogens and stimulate macrophage action
c
Occur late in the disease process, after the pathogen is almost eliminated
d
Require emergency treatment

Answers

Answer:

Inhibit the growth of pathogens and stimulate macrophage action

The correct answer is B

trình bày cơ chế hấp thụ và chuyển hóa lipid từ đường tiêu hóa ở người?

Answers

Trong dạ dày được tách rời khỏi các chất thực phẩm khác. Trong ruột non, mật hoa tiết ra chất béo trong khi các enzyme tiêu hoá chúng. Các tế bào ruột hấp thụ chất béo. Các a - xít béo chuỗi dài tạo thành một cấu trúc lipoprotein lớn được gọi là một hạch nguyên tử có thể vận chuyển chất béo qua hệ bạch huyết.

If a bacterial isolate show intermediate to moderate resistance to an antimicrobial, how might this drug still be successfully used in the treatment of this microbe

Answers

Answer:

Due to its effectiveness.

Explanation:

This drug still be successfully used in the treatment of this microbe because of its effectiveness on the microbes. All the microbes did not got resistance against the antimicrobial chemical and they are not full proof from the antibiotics so that's why the antimicrobial are used in the treatment of microbes. If all the microbes attain resistance against antimicrobial drug so it can't any affect on the microbes.

Which statement describes Mendel’s hypotheses regarding gametes?
A) gamete carries two genes for a trait.
B) gamete carries one allele for a gene.
C) gamete can carry multiple alleles for a trait.
D) Some gametes are dominant and some are recessive.

Answers

Answer:

The correct answer is B. A gamete carries one allele for a gene.

Explanation:

Gamete (also called sex cell or reproductive cell) is a haploid cell (having half number of chromosome as compared to the parent cell) that is produced through a cell division, termed as meiosis in sexually reproducing organisms.

According to the Law of segregation given by Gregor Mendel-

During the process of gamete formation, the two alleles of each gene segregate from one another so that a gamete carries one allele for a gene.

Thus, option B) is the right answer.

Answer:

B.

Explanation:

*Which of the following are all direct methods of flood contro
a. soil conservation, dams, artificial levees
b. dams, artificial levees, overflow channels
C. floodplains, artificial levees, dams
d. dams, overflow channels, soil conservation

Answers

*Which of the following are all direct methods of flood contro
b. dams, artificial levees, overflow channels

A researcher dried a feedstuff and determined that it contained 10 percent moisture. he took 1 gram (dry) of it and combusted it in the bomb calorimeter. the calorimeter contains 1 kg of water. The temperature was raised 2.7 degrees centigrade. Two kilograms (2000 grams) of dry matter of the material was fed to a pig each day for several days. the fecal collections of the pig averaged 200 grams dried per day for the last few days. the feedstuff analyzed 2.41 percent nitrogen (dry basis); the feces (dry basis) analyzed 4.6 percent nitrogen. (hint: the feedstuff contained _____ grams protein, the feces contained _____ grams protein.)

Answers

Answer:

Explanation:

The objective of the information given is to calculate the apparent digestible dry matter present in the feedstuff(%) and the apparent digestibility of the protein?

From the given information:

The apparent digestible dry matter present is:

[tex]=\dfrac{ (\text{Dry matter fed to the pig} - \text{Fecal matter of the pig} )}{\text{Dry matter fed to the pig}} \times 100 \%[/tex]

where;

Dry matter fed to the pig = 2kg = 2000 g

Fecal matter of the pig = 200

The apparent digestible dry matter present = [tex]\dfrac{2000-200}{2000}\times 100\%[/tex]

[tex]=\dfrac{1800}{2000}\times 100\%[/tex]

= 90

Amount of Nitrogen(i.e. the protein) content present in the feedstuff = 2.41%

i.e.

2.41 g/100 g   OR   48.2 g/2000 g feed

Amount of protein present in feces = 4.6% (4.6 g/100 g  OR  9.2g/200g of feed)

apparent digestibility of the protein is:[tex]=\dfrac{\text{Amount in feed }- \text{Amount in feces}}{\text{Amount in feed }}\times 100[/tex]

[tex]= \dfrac{(48.2 - 9.2)}{48.2}\times 100[/tex]

[tex]= \dfrac{39}{48.2}\times 100[/tex]

= 81%

Here can you help me on this?

Answers

Answer:

Selective breeding

Selective breeding is when u choose 2 organisms with certain desirable characteristics and bread then together

Animals are selectively bread 4 many reasons

- To have a higher yield (meat, milk, eggs)

- Be able to run faster

The same nutrient is one of the
slowest moving nutrients and is
often the limiting nutrient in
aquatic ecosystems. What is this
nutrient?
A. carbon
B. nitrogen
C. phosphorus

Answers

The answer is c

Phosphorus is often the limiting nutrient, or nutrient that is most scarce and thus limits growth, in aquatic ecosystems.

Hope it helps

Many North Americans have misconceptions about their own protein needs and the roles of protein in the body.

a. True
b. False

Answers

Answer:

I think its true hope this helped

Many North Americans have misconceptions about their own protein needs and the roles of protein in the body True.

What is Proteins?

The body is made up of protein, which may be found in almost every organ, tissue, and body part, including muscle, bone, skin, and hair. It contributes to the production of hemoglobin, which transports oxygen in the blood, and enzymes, which drive numerous chemical reactions.

Twenty-plus fundamental building blocks known as amino acids are used to create protein.

The essential amino acids, also known as histidine, isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine, must be obtained from diet.

Therefore, Many North Americans have misconceptions about their own protein needs and the roles of protein in the body True.

To learn more about North America, refer to the link:

https://brainly.com/question/19339803

#SPJ6

Suppose that you are able to sequence a portion of Dr. Ogden's genome. The DNA sequence below is a stretch of one of the genes.

TAC CGT ATA AAA AAT TAA CTT AGA CGT GCT CTT TCT CTT CGA GAA GAC ATA TTA CTT CGT TGA ATC
Given the DNA sequence above type the mRNA processed transcript (assume that TCT CTT CGA GAA GAC ATA is an intron).

Answers

Answer:

huh

Explanation:

fam what is that

The mRNA processed transcript will be: AUG GCA UAU UUU UUA AUU GAA UCU GCA CGA GAA AAU GAA GCA ACU UAG.

What is transcription?

In genomics, transcription is the method of generating an RNA copy of a gene's DNA sequence. This copy, known as messenger RNA (mRNA), transports the protein information encoded in the gene's DNA.

This RNA copy, known as messenger RNA (mRNA), contains the genetic information required for a cell to produce proteins.

It transports information from the cell's nucleus to the cytoplasm, where proteins are produced.

The entire gene is copied into a pre-mRNA, which includes exons and introns, during transcription. Introns are removed and exons are joined to form a contiguous coding sequence during the RNA splicing process.

Thus, as the introns are getting removed completely, the mRNA sequence for the given DNA sequence will be: AUG GCA UAU UUU UUA AUU GAA UCU GCA CGA GAA AAU GAA GCA ACU UAG.

For more details regarding transcription, visit:

https://brainly.com/question/14136689

#SPJ2

10. Which process uses special proteins on the surface of the membrane
to identify specific molecules for transport into the cell?
a. phagocytosis
b. pinocytosis
C. receptor-mediated endocytosis
d. exocytosis

Answers

Answer:

C. Receptor-mediated endocytosis

science
the imaginary lines which divide the earth into areas of 15º are called

Answers

[tex]\huge\colorbox{purple}A\colorbox{blue}n\colorbox{purple}s\colorbox{blue}w\colorbox{purple}e\colorbox{blue}r [/tex]

[tex]\color{red}{⚠TheQueenNoNeedAKing⚠} [/tex]

[tex]\color{Violet}\rm{Answer:}[/tex]

longitude lines

longitude lines. Imaginary lines, also called meridians, running vertically around the globe. Unlike latitude lines, longitude lines are not parallel. Meridians meet at the poles and are widest apart at the equator. Zero degrees longitude (0) is called the prime meridian.

[tex]\color{Violet}\rm{☘︎Hopeithelps!}[/tex]

__________________________________

“But you, my Lord, are a God of compassion and mercy; you are very patient and full of faithful love.” — Psalm 86:15 ❤

__________________________________

The enzyme could become spatially distorted, thus reducing the ability of the active site to catalyze the reaction. Tight enzyme-substrate binding will reduce the forward rate constant for the reaction. Tight binding of the enzyme to its substrate will pull the substrate out of solution, thus decreasing the driving force for the forward reaction. Tight binding of the enzyme to its substrate will result in the enzyme-transition state complex being higher in energy than with weaker binding. All of the above.

Answers

Answer:

All of the above.

Explanation:

All the given options are the potential disadvantage of an enzyme that have a very high affinity for its substrate.

The enzyme can be distorted spatially and thus reduces the ability to catalyze the reaction of the active site.

The tight binding of an enzyme to a substrate results in enzyme transition state complex which is higher in energy.

The tight binding also pulls the substrate out of the solution and decreases a driving force in the forward reaction.

Describe how decomposers link the living and non-living parts of an ecosystem

Answers


Decomposers are living organisms that breaks down other living and non-living things into smaller parts.

Decomposers can recycle dead plants and animals into chemical nutrients such as carbon and nitrogen that are released back into the soil, air and water as food for living plants and animals.
Decomposers are living organisms that breaks down other living and non-living things into smaller parts. ... Decomposers can recycle dead plants and animals into chemical nutrients such as carbon and nitrogen that are released back into the soil, air and water as food for living plants and animals.

Decomposers play a critical role in the flow of energy through an ecosystem. They break apart dead organisms into simpler inorganic materials, making nutrients available to primary producers.

Decomposers, such as bacteria, fungi, termites, and earthworms, are scavengers that feed on the organic material found in dead producers and consumers. They break down the organic material to the nutrient level. Nutrients in soils are essential for producers to grow. Nutrients include nitrogen, carbon, and phosphorous. Thus, dead consumers (and producers) are recycled back into new producers.

Some experts attribute the increase in ADHD diagnoses to an increased awareness of the disorder, while others attribute the increase to ______ diagnoses.

Answers

Answer:

incorrect

Explanation:

Attention-deficit/hyperactivity disorder (ADHD) is one of the most common neurodevelopmental disorders affecting children. ADHD is characterized by different behaviors that include one or more of the following symptoms: inattention (poor concentration), impulsivity (interrupting behavior) and hyperactivity (state abnormally active). It has been reported that DHD diagnoses in children between 4 and 17 years of age dramatically increased from 6 percent (6%) during the period 1997-1998 to 10 percent (10%) during the period 2015-2016. Although the causes of this increase have not been established, the American Psychiatric Association (APA) indicates that the increase might be due to the increased access of communities historically relegated to receive care and decreased stigma to be diagnosed with ADHD. Other possible causes range from chemical factors to unhealthy habits during pregnancy (e.g., smoking, substance abuse, poor nutrition). On the other hand, it has also been proposed that this increase may be as a result that ​ADHD is often misdiagnosed and confused with other conditions (e.g., bipolar disorder, autism, kids being kids, etc).

which method of evolution best defines the figure:


A. fossilization

B. non-random mating

C. natural selection

D. gene flow

Answers

Answer:

C) Natural Selection

Explanation:

which leaf carries out more photosynthesis and explain why

Answers

Answer:

Explanation:

palisade layer

The upper, palisade layer captures most of the sunlight and carries out most of the photosynthesis. The columnar cells of the palisade layer contain many chloroplasts.

The total magnification produced from a 15x ocular and a 4x objective would be

Answers

60. To get total magnification you simply multiply ocular by the objective.

In the population of plant K, each plant has only red flowers or only white flowers. A farmer collected the seeds from plant K with red flowers to grow new plants. Explain why the new plants will have only red flowers

Answers

Answer:

nose

Explanation:

nosenosenosenosenosenosenosenosenosenosenose

The new plants will have only red flowers because the trait for red flowers is determined by a dominant gene, and all the plants in population K have the same homozygous genotype for the flower color.

In genetics, the flower color trait in population K is determined by genes present in the plants' DNA. There are two alleles, or gene variants, for the flower color: one for red flowers (let's call it R) and one for white flowers (let's call it r). The gene for red flowers (R) is dominant, meaning that even if only one copy of the gene is present in an individual's genotype (heterozygous), it will produce the red flower phenotype. On the other hand, the gene for white flowers (r) is recessive, which means it will only produce the white flower phenotype if two copies are present in the genotype (homozygous recessive).

In population K, all the plants have only red flowers, indicating that they must have the genotype RR. Since all the plants are homozygous for the dominant red flower gene (RR), when they reproduce, they can only pass on the dominant allele R to their offspring. As a result, all the new plants that grow from the seeds collected from these plants will also have the genotype RR and, therefore, express the red flower phenotype.

Since there are no plants in population K with the genotype rr (homozygous recessive), which is necessary for white flowers, there is no chance of white-flowered plants appearing in the new generation. Thus, the new plants will have only red flowers due to the uniformity of the homozygous dominant genotype in the original population.

To learn more about population, here

https://brainly.com/question/15889243

#SPJ2

La polidactilia en la especie humana se debe a un alelo dominante. Entre Francisco y Martha, ambos abuelos de Santiago, uno de ellos tenía polidactilia, sin embargo Juan su hijo (papá de Santiago) nació normal. A pesar de ello Santiago es polidactílico. La explicación a esta situación es que

Respuestas:
A)Como Juan nació normal (aa) la única posibilidad para que Santiago su hijo naciera con polidactilia era que su madre lo fuera también.

B) Como uno de los abuelos era aa (homocigoto recesivo-normal) y el otro Aa (heterocigoto-polidactílico), Juan nació probablemente aa (homocigoto recesivo-normal) y por ello no hay manera que Santiago naciera polidactílico.

C) Como uno de los abuelos era aa (homocigoto recesivo-normal), Juan nació probablemente aa (homocigoto recesivo- normal) y por ello Santiago es polidactílico.

D) Como Francisco y Martha eran Aa (ambos heterocigotos-polidactílicos), Juan nació probablemente AA (homocigoto dominante- polidactílico) y por ello Santiago es polidactílico.

Answers

Answer:

A)Como Juan nació normal (aa) la única posibilidad para que Santiago su hijo naciera con polidactilia era que su madre lo fuera también.

Explanation:

La polidactilia es una malformación causada por un alelo dominante asociada con al aparición de más de 5 dedos en cada pie o más de 5 dedos cada mano. Un alelo dominante es una variante génica capaz de enmascarar la expresión de un alelo recesivo en individuos heterocigotos, es decir, en individuos portadores de una copia del alelo dominante y una copia del alelo recesivo para un gen en particular. De este modo, un alelo dominante es por definición aquel que será expresado en el fenotipo, con lo cual el único modo en el cual Santiago sea portador del alelo dominante causante del rasgo "polidactilia" es que él lo haya heredado, ya sea del padre o de la madre (es importante aclarar que también el alelo dominante puede haber surgido por mutación en la línea germinal). En este caso sabemos de acuerdo al enunciado que el padre de Santiago no tiene polidactilia y por lo tanto no es portador del alelo dominante, con lo cual se espera que Santiago haya heredado esta condición de su madre.

Phospholipids are lipids that form most of the structure of the cell membrane. True or false

Answers

I could be wrong but I believe the answer is True.

Refer to the given diagram to answer Question 9
Y-ANTIBODIES
X-WBC
V-RBC
W-PLATELETS
QUESTION 9
ry
Which of the labelled structures in the diagram match the function below.
1.
Contains haemoglobin
II.
Carries out phagocytes
III.
Produces antibodies
J.
Involves in blood clotting
IV
A.
V
Y
W
В.
W
V
Y
С.
V
Y
X
w
D
Y
X
W​

Answers

Answer:

C

Explanation:

Answer c contains all the list listed

Please answer both ASAP Will Mark brainliest

Answers

Answer:

Mitosis Has Single Nuclear Division results in 2 Nuclei

2 Daughter Cells Are Produced 2 diploid cells.

Meiosis Has 2 Rounds of Nuclear Division resulting in 4 Nuclei

4 Daughter Cells Are Produced. 4 haploid cells

Both Have Cells divide and Reproduce

Explanation:

Which of these provides the best evidence for the plate tectonic theory?

The rise of magma by the convergence of earths plates

The destruction of earths magnetic field by the rotation of earths core

The variations in the age of rocks at different distances from the mid ocean ridges

The difference in the shapes of the Atlantic ridge and the coastlines of continents

Answers

Answer: C

Hope this helps!

a) In how many cases in the genetic code would you fail to know the amino acid specified by a codon if you knew only the first two nucleotides of the codon?
b) In how many cases would you fail to know the first two nucleotides of the codon if you knew which amino acid is specified by it?

Answers

Answer:

a) 28 cases

b)  3 cases

Explanation:

a) From the table of genetic codes, there are 28 codons that specify more than one amino acid assuming only the first two nucleotides are considered. In these cases, one cannot outrightly specify the amino acid the genetic codes are coding for without knowing the last nucleotide of the codes. For example, UU can be for Phenylalanine or Leucine, CA can be for Histidine or Glutamine, etc.

b) From the table of genetic codes, the first two nucleotides of Arginine can be either of CG or AG, that of Serine can be either of UC or AG while that Leucine can be either of CU or UU. Only in these 3 cases would one fail to know which are the first two nucleotides assuming the name of the amino acids are given.

See the attached image for the genetic code.

What would you say to a friend that says "GMOs are dangerous to human health"?

Answers

Everything have both positive and negative impacts

Gmos( genetically modified organisms ) are good and dangerous both

if we carefully practice genetic engineering then it is beneficial but if we use it only for our income source without caring about its worst effects then its very dangerous

The diagram below shows an energy pyramid for various trophic levels in an ecosystem. According to this pyramid, which trophic level has the LEAST amount of energy?
1. A
2.B
3.C
4.D​

Answers

Answer:

A

Explanation:

This animal has a protostome developmental pattern and a trochophore larva. Identify the major clades that this animal belongs to

Answers

Answer:

Lophotrochozoans (it is a protostome)

Explanation:

Lophotrochozoa is a group (clade) of protostome animals, i.e. animals that undergo a developmental pattern in which the blastopore develops into the mouth. Lophotrochozoa clade includes bryozoans, annelids, molluscs, brachiopods, and platyhelminthes. Most lophotrochozoans have either a lophophore or trochophore larvae during the planktonic stage. A trochophore larva is a marine planktotrophic larva with several bands of cilia that form the locomotory organ (i.e., the prototroch), which is only found within the Lophotrochozoans.

When the larva and the adult form of an organism are different from each other this type of development is called indirect development. For example Porifers and platyhelminthis.

the larval form is Lophotrochozoans (it is a protostome)

Lophotrochozoa is a group (clade) of protostome animals, i.e. animals that undergo a developmental pattern in which the blastopore develops into the mouth.

Lophotrochozoa clade includes bryozoans, annelids, molluscs, brachiopods, and Platyhelminthes.

Most lophotrochozoans have either a lophophore or trochophore larvae during the planktonic stage. A trochophore larva is a marine planktotrophic larva with several bands of cilia that form the locomotory organ (i.e., the prototroch), which is only found within the Lophotrochozoans.

For more information, refer to the link:-

https://brainly.com/question/2817451

Other Questions
A business manager finds that the building expense each month is completely uncorrelated with revenue levels. What should the business manager assume about this cost? What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience. From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Please help!!!hi,can you please help me with this?thanks can someone answer this please one of the main ways that federal and state courts differ is the process of discovery that is required in each court. true or false? What is the reporters motive in article 1?What is the reporters motive in article 2?Which term from Senator Nelsons quote in article 2 is an example of bias? Help Me please!!!!! Rn calculate the mass in 4.05*10^22 molecules of calcium phosphate Which event is inferred by most scientists to be responsible for a climate change that has recently led to a decrease in the size of most glaciers? * a decrease in the rate of divergence of lithospheric plates along a mid-ocean ridge O a decrease in the amount of insolation reaching Earth's surface an increase in the amount of greenhouse gases in Earth's atmosphere an increase in the amount of vegetative cover in the tropics How is an ammeter connected in a circuit to measure current flowing through it? can someone please explain how to complete this thanks A skier of weight 700 N is pointed down a ski hill that has a slope angle of 25 above horizontal.What is the component of his weight pulling him down the slope.O 634NO 326NO 296NO 700N The following is a comprehensive problem which encompasses all of the elements learned in previous chapters. You can refer to the objectives for each chapter covered as a review of the concepts.Note: You must complete part 1 before completing part 2.Based on the following data, prepare a bank reconciliation for December of the current year:a. Balance according to the bank statement at December 31, $283,000.b. Balance according to the ledger at December 31, $245,410.c. Checks outstanding at December 31, $68,540.d. Deposit in transit, not recorded by bank, $29,500.e. Bank debit memo for service charges, $750.f. A check for $12,700 in payment of an invoice was incorrectly recorded in the accounts as $12,000.Enter all amounts as positive numbers.Kornett CompanyBank ReconciliationDecember 31, 2014SubtotalAdjusted BalanceDeductAdjusted Balance Simplify (2x^2 + 4x) - (7x - 3x^2 + 5) A shipping carton is in the shape of a triangular prism. The base area of the triangle is 6 inches squared and the the height of the prism is 15 inches. how many cubic inches of space are in the carton? Describe any six risky situations youth are frequently exposed to