Question Progress
Simplify fully
a) 8c^4d^5÷2c3^d^3
b)9a3b5/3ab2​

Answers

Answer 1

Answer:

A.) 4cd^2

B.) 3a^2b^3

Step-by-step explanation:

simplify by following the rules to adding exponents


Related Questions

Write the ratio as a fraction in simplest form.

51:9

Answers

Answer:

The ratio of 51:9 in it's simplest form is 17:3.

3.) There are 3 brothers. The first brother is twice as old as the second. The second is twice as old as the third.
If the sum of their ages is 28, how old is each brother?

Answers

Answer:

The first brother is 16, the second brother is 8 and the third brother is 4.

Step-by-step explanation:

Since the sum of all the brothers  is 28, that means the cap of how old the oldest can be is 28. I just stated with numbers less then 28 that were dividable by two which means all the numbers had to be. So 16 for the first, 8 for the second and 4 for the youngest is the right answer I hop.

(a) The perimeter of a rectangular garden is 314 m.
If the length of the garden is 85 m, what is its width?
(b) The area of a rectangular window is 4800 cm
2
If the width of the window is 64 cm, what is its length?

Answers

Answer:72 for the garden and 75 for the window

Step-by-step explanation:

answer fast !!!!!!!!!

Answers

Answer:

(a^7)/64

Step-by-step explanation:

1/(8×8) × a^7=1/64 × a^7

19) Find the acros F(x) = x4 + 8x? -​

Answers

Answer:

F'(x)=4x3+16x

Step-by-step explanation:

PLEASE help I really have to get this right!
The population of a city increases by 4,000 people each year. In 2025 the population is projected to be 450,000 people. What is an equation that gives the city's population p (in thousands of people) x years after 2010?
A.p=4x+50
B.p-450=4(x-5)
C.p-15=4(x-450)
D.p=4x+15

Answers

Robert Dwayne Junior

3Y - 15 LESS THAN 7Y+ 6

Answers

Answer:

y>-9/4

use this site too, put in an any equation itll solve it in a second and give you a step by step thing to show you how to do it.

simplify 6(4x-2)+10 pls i need it

Answers

Answer:

2(12x-1)

Step-by-step explanation:

expand the expression

24x-12+10

add the constants

24x-2

take out 2, since it is common

2(12x-1)

Which set of statements would describe a parallelogram that can always be classified as a rhombus?

I. Diagonals are perpendicular bisectors of each other
II. Diagonals bisect the angles from which they are drawn
III. Diagonals form four congruent isosceles right triangles

Answers

The correct answer is (4) I, II, and III.

Please help me if you can​

Answers

Answer:

1)-9x^5 + 7x^2 + 3    2)  -2x2 • (x - 7)      3)  -23v^2 + 7v + 4    4) is just 7x

What is the expanded form of the expression ∑i=0⇵4 i^4? a) 0^2+4^2 b) 1^4+2^4+3^4+4^4 c) 0^4+1^4+2^4+3^4 d) 0^4+1^4+2^4+3^4+4^4

Answers

Answer:

Um what is this

Step-by-step explanation:

Find the sum of interior angles of a 10-sided figure. Explain what formula you used to get the answer.

Answers

Answer: 1440°

Step-by-step explanation:

To solve the above question, we'll use the formula (n-2) × 180. In this question, we are told that it has 10 sides. This implies that n= 10. Therefore, using the formula goes thus:

= (n - 2) × 180

where, n = 10

= (10 - 2) × 180

= 8 × 180

= 1440

Hlppppppppppppppppppppppp

Answers

Answer:

B, C, D, E

Step-by-step explanation:

Find an equation of the line perpendicular to the graph of 14x-7y=8 passing through the point at (-2,5)

Answers

Answer:

Equation of line perpendicular to given graph is:

[tex]y = -\frac{1}{2}x+4[/tex]

Step-by-step explanation:

Given equation of line is:

14x-7y=8

First of all, we have to convert the given equation into slope-intercept form to find the slope of the line

The slope-intercept form is:

[tex]y = mx+b[/tex]

Now

[tex]14x-7y=8\\14x-8 = 7y\\\frac{7y}{7} = \frac{14x-8}{7}\\y = \frac{14}{7}x - \frac{8}{7}\\y = 2x - \frac{8}{7}[/tex]

The co-efficient of x is 2 so the slope of given line is 2

Let m1 be the slope of line perpendicular to given line

The product of slopes of two perpendicular lines is -1

[tex]m.m_1 = -1\\2.m_1 = -1\\m_1 = -\frac{1}{2}[/tex]

The equation for line perpendicular line to given line will be:

[tex]y = m_1x+b\\y = -\frac{1}{2}x+b[/tex]

To find the value of b, putting (-2,5) in the equation

[tex]5 = -\frac{1}{2}(-2) + b\\5 = 1+b\\b = 5-1\\b = 4[/tex]

The final equation is:

[tex]y = -\frac{1}{2}x+4[/tex]

Hence,

Equation of line perpendicular to given graph is:

[tex]y = -\frac{1}{2}x+4[/tex]

Help quick what's 9+10

Answers

9+10=19.............

In a class of 40 students, 26 are girls and 14 are boys. What is the ratio of girls to the total number of students?

Answers

Answer:

13:20

Step-by-step explanation:

no. of girls=26

total no. of students =40

ratio of girls to total no. of students=26:40

which means, the ratio is 13:20

7x(42-22) +32 +4
please show work-

Answers

Answer:

140x+36

Step-by-step explanation:

hope this helps :)

The sixth-grade class is competing in the school field day. There are 32 girls and 56 boys who want to participate. Each team must have the same number of girls and boys. What is the greatest number of teams that can be formed? How many boys and how many girls will be on each team?

Answers

Answer:

8 teams each team will have 4 girls and 4 boys

Step-by-step explanation:

We use GCD to solve this

the GCD of 32 and 24 = 8

8 is the greatest number of teams.

each team must have equal number of boys and girls so divided by two

8/2 = 4

4 girls and 4 boys

I have attached how to do GCD.

If you need any clarification or more explanation pls do mention at the comment section

Hope this helps and if it does pls mark as brainliest answer thx

b) 7+2x/3 =5
helppppp

Answers

Answer:

4

Step-by-step explanation:

7+2x/3=5

7+2x. = 15

2x. =8

x. = 4

i hope it is helpful

Answer:

[tex] \frac{3x + 4}{2} = 9.5 \\ 3x + 4 = 19 \\ 3x = 15 \\ \boxed{x = 5}[/tex]

[tex] \frac{7 + 2x}{3} = 15 \\ 2x + 7 = 45 \\ 2x = 38 \\ \boxed{x = 19}[/tex]

Brian makes $40 per hour tutoring students in music
theory, and Rebecca makes $20 per hour walking
dogs. Last month, Brian worked for 5 fewer hours
than Rebecca did, and they earned a total of $1,300.
How many hours in total did they work at their
part-time jobs?
A) 25
B) 35
C) 45
D) 55

Answers

Answer:

55

Step-by-step explanation:

Answer: D.)

Step-by-step explanation:

40*5=200, This is Brians total $'s

1,300-200=1,100, This is Rebeccas total $'s

1,100/20= 55, This is the total hours worked.

The mean for this set of data is 18. Which number could be put in the blank to make this statement true?
16 10 22 ___
A. 84
B. 24
C. 48
D. 72

Answers

The answer is B, 24
Because if u do the math it will or should give u that

The mean of the data is 18 and the missing statement is x = 24

What is Mean?

The mean value in a set of numbers is the middle value, calculated by dividing the total of all the values by the number of values.

Mean = Sum of Values / Number of Values

Given data ,

Let the data be represented as A

Now , the value of A = 16 , 10 , 22 , x

Let the mean of the data be M = 18

To find the mean of the data set, we need to add up all the numbers and divide by the total number of numbers:

(16 + 10 + 22 + x) / 4 = 18

We can simplify this equation by multiplying both sides by 4 to get rid of the fraction:

16 + 10 + 22 + x = 72

Now we can solve for x by subtracting the three known numbers from both sides:

x = 72 - 16 - 10 - 22

x = 24

Therefore, the number that could be put in the blank to make the statement true is 24

To learn more about mean click :

https://brainly.com/question/15526777

#SPJ2

Which scales are equivalent to 1 inch to 1 foot? Select all that apply. Group of answer choices 1 to 12 (1/12) to 1 100 to 0.12 5 to 60 36 to 3 9 to 108

Answers

Answer:

1 to 125 to 609 to 108

Step-by-step explanation:

There are 12 inches in one foot so the equivalent ones are:

1 to 12

This shows that there are 12 inches in one foot so is equivalent.

5 to 60

5/60 = 1/12

This is equivalent because it shows that 12 inches are required to make a foot.

9 to 108

9/108 = 1/12

This is also equivalent for the same reasons as above.

Create a quadratic equation that would have two real solutions. Then,
explain why it has two real solutions without solving the equation.

Answers

Answer:

Thinking graphically, these correspond to the graph of the straight line (a) missing the graph of the parabola entirely, (b) kissing the parabola at one point or (c) cutting across the parabola and coinciding with it at 2 points.

Step-by-step explanation:

Explanation:

Graphically, a quadratic equation is a parabola and a linear equation is a straight line.

i hope it helps

Find the annual infiltration rate for the nearest 10th of a percent of a gallon of milk that increases the value from $1.51 to $2.03 over a period of seven years.

Answers

Answer:

7.429 cents

Step-by-step explanation:

Given that:

Price change = $1.51 to $2.03

Period of time = 7 years

Therefore, the annual inflation rate :

Difference in price / number of years

($2.03 - $1.51) / 7

$0.52 / 7

= 0.0742857 per year

= 0.0742857 * 100 (about 7.429 cents per year)

in the spring temperatures rise on average 6 degrees every 5 days. at that rate how many degrees would the temperature have risen after 30 days

Answers

Answer:

Ok, this is pretty simple. So, if it rises 6 degrees every five days, then we have to figure out how many "five days" are in 30 days. It would be 6! So now all we have to do is multiply. 6 times 6 equals 36 degrees.

The answer is 36 degrees.

Step-by-step explanation:

Answer:

36

Step-by-step explanation:

If it rises 6 degrees every 5 days, we just need to figure out how many 5 days are in 30 days. When you solve, you'll get 6. Now we can just multiply 6 x 6 = 36. Hope this helped, please mark brainliest if it did

(4n + 14) + (5 + 8n)

Answers

Answer:

12n+19

Step-by-step explanation:

(4n + 14) + (5 + 8n)

4n+14+5+8n

12n+19

2+0+3+4+9+6 ?? please

Answers

Hey there!

The answer is 24

2+0

2

2+3

5

5+4

9

9+9

18

18+6

24

Have a good day!

P.S. UMMMMMMMMM

Simpily the expression below: 2(4x + 5y)​

Answers

Answer: 8x+10y

Step-by-step explanation:

2(4x)= 8x

2(5y)= 10y

8x+10y

Help? Show work!
Triangle PQR ≅ Triangle XYZ
PQ = 3a + 4 and XY = 5a – 12. Find a and PQ.

Answers

Given:

[tex]\Delta PQR\cong \Delta XYZ[/tex]

[tex]PQ=3a+4[/tex]

[tex]XY=5a-12[/tex]

To find:

The value of a and PQ.

Solution:

We have,

[tex]\Delta PQR\cong \Delta XYZ[/tex]

[tex]PQ\cong XY[/tex]                            (CPCTC)

So,

[tex]PQ=XY[/tex]

[tex]3a+4=5a-12[/tex]

Isolating variable terms, we get

[tex]3a-5a=-4-12[/tex]

[tex]-2a=-16[/tex]

Divide both sides by -2.

[tex]a=\dfrac{-16}{-2}[/tex]

[tex]a=8[/tex]

Now,

[tex]PQ=3a+4[/tex]

[tex]PQ=3(8)+4[/tex]

[tex]PQ=24+4[/tex]

[tex]PQ=28[/tex]

Therefore, the value of a is 8 and the value of PQ is 28.

I need help cause I’m lazy to do it myself it’s 4 in the morning

Answers

Answer:

C. Mario should have multiplied the x-values by $6.50 to get the y values.

Step-by-step explanation:

Let's do it the way they said. If we were to multiply 1 by 65, it would be $65. If we did the same thing for 2, 2 x 65 is $130. This is incorrect because these values do not match up with the ones on the graph.

Decimal points are important in this case because it completely changes your answer. When you multiply 1 by 6.50, you get 6.50. Which is what's on the graph. Multiply 2 by 6.50 and you'll get $13, and so on.

So now we can conclude that the mistake Mario made was that he multiplied x by the wrong value (65), when it should have been $6.50.

Note: Hope this helps! Good luck on your test. :)

Other Questions
Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What is the mRNA and Amino Acids for: TACACCTTGGCGACGACT What caused the original creation of the Universe? How do we find out? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia List two equivalent numbers to 0.50 Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make? You know I never approved of it, pursued Utterson, ruthlessly disregarding the fresh topic.My will? Yes, certainly, I know that, said the doctor, a trifle sharply. You have told me so.Well, I tell you so again, continued the lawyer. I have been learning something of young Hyde.The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. I do not care to hear more, said he. This is a matter I thought we had agreed to drop.The Strange Case of Dr. Jekyll and Mr. Hyde,Robert Louis StevensonWhere in the plot is this passage found?the expositionthe rising actionthe falling actionthe resolution How do blood types react in a transfusin ? Tarshiss article is mainly about A. the U.S. Navys secret missions B. the construction of the Titanic C. creatures that thrive in the deep seaD. one mans quest to find the Titanic Which of the following is an example of a topic that is too narrow or not going have enough information?Explaining the process of solar power.The effects of drought on farmers in California.The process of inflating a flat bicycle tire.Comparing the North and South poles. plz help me with this PLS ANSWER QUICKLY AND ILL MARK U BRAINLIESTWhat is one similarity between a sitcom and one-act playspecific types of jokesthey both have one acta main messageone main character What current passes through a 1 kW heater with 25 V across it? 1) Choose the correct answer. I NEED HELP ASAPThe destination of many Roman Catholic pilgrimages was ______.the Holy Landthe Holy Roman EmpireAfricaKievRome The incidence of cystic fibrosis, a recessive genetic disorder in the Caucasian population of United States, is 1 in every 2,500 individuals. Find the number of heterozygous carriers. (p + q = 1, p2 + 2pq + q2 = 1)