1) Choose the correct answer. I NEED HELP ASAP


The destination of many Roman Catholic pilgrimages was ______.

the Holy Land

the Holy Roman Empire

Africa

Kiev

Rome

Answers

Answer 1

Answer:I think its holy land

Explanation:

throughout the centuries, pilgrimage destinations have expanded greatly, going well beyond the three main destinations — the Holy Land, Rome, and the Camino de Santiago.


Related Questions

What caused the end of the lumber boom in Louisiana?
O The kind of lumber produced in Louisiana fell out of favor with construction companies.
O Progressive labor restrictions reduced the profitability of the lumber industry.
O The majority of pine and cypress forests in the state had been largely destroyed.
O Northern factories were able to buy lumber for less from the New England states.
HURRY PLeASE

Answers

Answer:

the 2nd one

Explanation:

The kind of lumber produced in Louisiana fell out of favor with construction companies. Progressive labor restrictions reduced the profitability of the lumber industry. The majority of pine and cypress forests in the state had been largely destroyed

Answer: The answer is c

Explanation:

In 1965 King and his wife, Coretta Scott King, led demonstrators on a
historic 54-mile march that took five days, from where to where?

Answers

Answer:King and his wife, Coretta Scott King, lead demonstrators on the fourth day of a historic five-day march in 1965. Starting in Selma, Alabama, where local African Americans had been campaigning for the right to vote, King led thousands of nonviolent demonstrators 54 miles to the state capitol of Montgomery.

Explanation:

Rather than go to war with the British in 1807, Jefferson passed the unpopular __________________ to prohibit trade with Britain, France, and their colonies.
a.
Townsend Acts
c.
Navigation Acts
b.
Embargo Act
d.
Nonintercourse Act

Answers

Answer:

Embargo act

Explanation:

All of these events depict an internationalist foreign policy EXCEPT

a
Enacting high tariffs
b
Free trade agreements
c
The Korean War
d
The Cold War

Answers

Answer:

B free trade agreements

Explanation:

Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership.

Answers

Answer:

Hitler youth

Explanation:

The Nazi Youth began in Germany after Hitler became the chancellor in 1930s. It was an organization set up by Hitler in 1933 for training and educating boys with Nazi beliefs. Young people were important to the Nazis as they thought to be the future of the country. The Nazi Youth consists of almost 60 per cent of German boys. The youth became eligible for the Hitler Youth at the age of 13. German boys needed to become members of the Hitler Youth.

Do you think that the distance from the capital, Rome, could have influenced the possible lack of loyalty to the emperor in the provinces?

Answers

Yes I believe it could

CAN SOMEBODY WRITE ME A 500 WORD ESSAY ABOUT THE INAUGURATION THAT HAPPENED TODAY PLZZ!!

Answers

Answer:

Bush delivered his second inaugural address after being sworn in for his second term. In his address Bush promised to keep his word and fulfill his duty as president of the United States. These duties have not been upheld according to the numerous protestors who showed up at his Inauguration. In his Inaugural Address Bush discussed many things. The inaugural address was a speech which would reassure the American people that President Bush will lead us to victory. In the Address Bush promises to fulfill.

What are the characteristics of a periphery country according to Wallerstein's world system theory?
A)
Periphery countries have low income, low levels of education, and are
typically in the primary sector of the economy
Periphery countries have high income, advanced technology, generate the
most wealth, exploit developing countries, and are typically in the tertiary
sector of the economy,
B)
Periphery countries are the fastest economically developed countries,
known as the Asian Tigers, and are typically in the industrial or
manufacturing sector of the economy
Periphery countries have processing from periphery and core countries,
cheap labor, exploit underdeveloped countries, and are typically in the
secondary sector of the economy,
D)
L

Answers

Answer:

I believe it's A

Help please Why would a samurai kill them self

Answers

Answer:

this was called seppuku and it was a honorable way that soldiers or other samurais could end their lives to save their honor after doing something shameful

Explanation:

Which action is best described by this excerpt George washington

Answers

My party’s in power in the city, and it’s goin’ to undertake a lot of public improvements. Well, I’m tipped off, say, that they’re going to lay out a new park at a certain place. I see my opportunity and I take it. I go to that place and I buy up all the land I can in the neighborhood. Then the board of this or that makes its plan public, and there is a rush to get my land, which nobody cared particularly for before. Ain’t it perfectly honest to charge a good price and make a profit on my investment and foresight? Of course, it is. Well, that’s honest graft.

—George Washington Plunkitt, Plunkitt of Tammany Hall, 1905

Which action is best described by this excerpt?

Answer:

Political machines justified corruption while providing benefits to communities.

Explanation:

From this excerpt, it can be deduced that "Political machines justified corruption while providing benefits to communities." This is because it is believed that Geroge Washington Plunkitt, a former New York senator probably through illegal means of getting the right information decided to buy lands where he's sure that the United States government will eventually want to use. Thereby selling the land to the government and making a huge amount as profit from the transaction.

1. What does this image say to you? Be specific.
2. Can you relate to this woman and her two children?

3. Approximately how old do you believe this woman to be? Her children? What made you come to that conclusion?

Please Help Its for a DBQ

Answers

Answer:

1. What does this image say to you? Be specific.

The image depicts sadness, despair, economic plight, poverty. It depicts hopelessness. The picture is one of the most famous taken during the Great Depression of the 1930s.

2. Can you relate to this woman and her two children?

She's very likely their mother, for the way that the two children cling to her. If not, she could be their aunt or step-mother. She is definitely not likely to be family unrelated to the children.

3. Approximately how old do you believe this woman to be? Her children? What made you come to that conclusion?

The woman must be in her late 30s or early 40s. The children are probably around 5 or 6. Their ages can be inferred by their physical appearance.


T/F: The hardships/challenges faced by the colonist were minimal in comparison to the opportunities gained.

Answers

Answer: True

Explanation:

How did John Locke theories influence the Declaration of Independence. Select two answers

Answers

His theories on natural rights led the text to mention life, liberty, and the pursuit of happiness.

Answer:

i know a lot about locke

Explanation:

His theories on natural rights led the text to mention life, liberty, and the pursuit of happiness.

hope this helps

Hello

Can anyone help me with this 12 marker question


I need answer in 10 min

Answers

Answer:

????????????????????

Answer:

???????????????????????????

if one party disagrees with a ruling from state appellate court, its appeal will be heard first by which type of court
A. U.S. Supreme Court
B. U.S. Court of Appeals
C. State supreme court
D. State trail court
Please help :(

Answers

Answer:

B

Explanation:

Answer:

The answer is C. State supreme court

Explanation:

The next court that would hear an appeal from the State appellate court would be the the state supreme court.

When a state trial heads to a court, it first goes to the State trial courts. If a disagreement is made then it would go the the state appellate court to hear the appeal. Then, it would head to the State supreme court if another appeal is made. Which then would head the the U.S. Supreme Court where both state and federal requests are reviewed.

Hope I helped!

Can someone help me out ???

Answers

Answer: the first one

Explanation:

Answer: the answer is your mom

Explanation: trust me l took the test :)

GIVING BRAINLEIST+20 POINTS

What was one restriction placed on free African Americans?
O A. They were responsible for paying for the freedom of their enslaved
OB. They had to pay for public services that were free for white
OC. They were not allowed to participate in antislavery organizations.
D. They were forbidden in many states to learn to read and write.
relatives.
Americans.

Answers

Answer: FIXED VERSION: D, They were forbidden in many states  to learn to read and write. Such as in a story this African American girl, had bodyguards to get into a school but her parents had the money because she was so smart that she got in but there were no other african americans with her. Many african americans had their own way less educated schools. I hope this helped anyone who finds it

Explanation:

Answer:

D

Explanation:

what is the important idea of ​​the declaration of independence of the United States

Answers

Answer:

People have certain Inalienable Rights including Life, Liberty and Pursuit of Happiness.

Explanation:

1. Who does the person on the left represent (look at what he’s holding)?
2. Who does the person on the right represent (holding)?
3. What is the main idea of the cartoon?
4. What do you believe was the general perception of the Populist Party at the time?

Answers

Answer:

4.what do you believe was the general perception of the populist party at the time

MARKING BRAINLIEST!!
Which particle has a high rate of deposition?
O a low-density particle
O a small particle falling off a cliff
O a particle with jagged, rough ends
O a large round particle settling on a surface

Answers

Answer:

A low density particle

Explanation:

Answer:

A low-density particle

Explanation:

I took the test on Edge 2021 :)

do you think hoover did a good job of dealing with the depression

Answers

Answer:

yes

Explanation:

Dnsxhospuclhxaohxahxosohssoohcsos

Giving up worldly desires is a main idea of what philosophy?
Group of answer choices

A. Confucianism

B. Legalism

C. Realism

D. Daoism

Answers

Daoism encourages the importance of nature

Answer:

D. Daoism

Explanation:

Daoism teaches that people should give up worldly desires and encourage the importance of nature.

PLS HELP FAST, IM FAILING LOL
What is true about life under slavery?
A. Slave owners discouraged slaves from adopting elements of white
culture
B. Slave owners did not pay slaves for their work,
c. Enslaved African Americans had equal rights to those of white
people
D. Slaves had a great deal of freedom other than choosing where to
work.

Answers

Answer:

[tex]\boxed {\boxed {\sf B. \ Slave \ owners \ did \ not \ pay \ slaves \ for \ their \ work}}[/tex]

Explanation:

Let's analyze each answer choice. Remember, we are looking for what life under slavery was like.

A. Slave owners discouraged slaves from adopting elements of white culture

This is not true. Slaves were encouraged to assimilate and abandon their own African cultures.

B. Slave owners did not pay slaves for their work

This is true. Slaves were treated horribly, forced to do strenuous tasks for many hours, and never compensated for their hard work.

Even though we just found the likely answer, let's check the last two.

C. Enslaved African Americans had equal rights to those of white people.

This is absolutely false. Slaves were considered to be inferior and they had no rights, like voting or owning property.

D. Slaves had a great deal of freedom other than choosing where to work.

This is also false. Slaves had no autonomy and every aspect of their life was controlled by the slave owner.

The correct answer is B. Slave owners did not pay slaves for their work

It's B on Ap3x

Slave owners did not pay slaves for their work

why is the inauguration on January 20th

Answers

Answer:

The Constitution originally set a president's term to start March 4 the year after the election was held. Back in the late 1700s when America gained its independence, a lot more needed to be done with a lot less to prepare for a new presidential administration.

As the decades wore on and technology advanced after the Industrial Revolution, cross-country communication and travel made it easier to coordinate the transfer of power. The 20th Amendment, ratified in 1933, shortened the time between the election and inauguration from four months to two.

Explanation:

hooppppeee it helppppppeddddd

Answer:

Roosevelt, January 20, 1937. The American Presidency Project. The Constitution of the United States had established March 4 as Inauguration Day in order to allow enough time after Election Day for officials to gather election returns and for newly-elected candidates to travel to the capital.

Summarize the war that made American episode 1?

Answers

Answer:

The dramatic documentary tells the story of the French and Indian War (1754-1763), which began in the wilderness of the Pennsylvania frontier and spread throughout the colonies, into Canada, and ultimately around the world.

Explanation:

hope this helps have a good rest of your day :)

Explain how the historical context affected a development taking place in the document

Answers

Answer:

The introduction to the specific rubric may take place once the Uniform Statewide. Admission ... the document, but it will be related to information in the document. ... Explains how audience affects the way Daniel Fitzpatrick presents his ideas ... Explain the geographic context for the historical development shown on this map.

Explanation:

Which of the following best describes Gerald Ford’s connection to the Watergate scandal?
Nixon narrowly avoided being removed from office, but he was so weakened by the scandal that Ford effectively became president.
Ford assumed the presidency after Nixon was impeached, but he was dragged down by his own involvement in the scandal.
Ford supervised Nixon’s impeachment and then went before Congress to justify his decision.
Ford pardoned Nixon after Nixon resigned and then went before Congress to justify his de

Answers

Answer:

Ford pardoned Nixon after Nixon resigned and then went before Congress to justify his decision.

Explanation:

President Richard Nixon's Watergate Scandal caused a disturbance among Americans. Breaking offices in the Watergate complex and cover-up by President Nixon during a CIA inquiry called for impeachment. Nixon resigned with the understanding that Ford would pardon him. Ford assumed office after Nixon resignation and continued to defend him in front of Congress to support his judgment.

The best option for Gerald Ford’s connection to the Watergate scandal is Ford pardoned Nixon after Nixon resigned and then went before Congress to justify his decision.

What is the Watergate scandal?

The scandal was said to be the product of  Nixon administration's constant move to cover up their involvement in the issue of the event of the break-in of the Democratic National Committee headquarters that is at the Washington, D.C. Which is known to be the Watergate Office Building.

Conclusively, The best option that tells more of Gerald Ford’s link to the Watergate scandal is when Ford pardoned Nixon after Nixon resigned and then went before Congress to make reasons why his decision is the best.

Learn more about Watergate scandal from

https://brainly.com/question/1687216

To what audience did Martin Luther King Jr. direct his speech?

Answers

Answer: (I'm assuming it deleted my first one because I linked an article that may help explain a little better) But I'd have to say the last one which is ' People who agreed with his ideas and had similar hopes and people who did not'

Explanation: Martin Luther King Jr. sought to raise the public consciousness of racism, to end racial discrimination and segregation in the United States. While his goal was racial equality, King plotted out a series of smaller objectives that involved local grassroots campaigns for equal rights for African Americans. not my words

Would you have worked for a joint-stock company? Why or Why not?​

Answers

Yeah I would work.

Experience purposes, I'd gain knowledge working through there.

I would earn job Bonuses and tips plus overtimes from joint stock company and marketing's.

The caste system or social divisions in ancient India were called the _______.
a.
Varnas
c.
Sanskrit
b.
Sudras
d.
the Vedas



Please select the best answer from the choices provided


A
B
C
D

Answers

Answer:

sudras

Explanation:

sudras were the laboring classes.

Answer:

The caste system or social divisions in ancient India were called the sudras

Other Questions
write the code for RNA from this DNA STRAND :AAAAAATTTTTTCCCGGGGTTTATATATC RIP grandsonhow does earths crust change earths surface [2.1 + (9.2 x 3.3)] x 0.8 PLEASE HELPPFill in the blanks in the following sentences with the logical word(s). Pay attention to the pronunciation.Spell out the following numbers in french: 1. 200:2. 256:3. 987:4. 875:5. 435:Based on the context, fill in the blanks in the following sentences with either the logical word or the appropriate forms of voir or croire. Say the whole sentence aloud.6. Est-ce que tu crois________Paul va aller au cinma ce soir?7. Elles_________les pommes sur la table.8.________vous aux fantmes?Oui! Vous_________ce fantme, l! Mais non, je ne le___________pas! i need help lol i forgot how to do this y32c-4-3 -2 -1-1+1 2 3 4-2+-3+-4+41What is the slope of the line? Since she tried blueberry ice cream Black Canary hasrefused to eat any other flavor. Explain why the Hitler youth had only mixed success among the young German people. You may use the following in your answer comradeship (friendship), compulsory membership. hi...need help....thank you.. A restaurant customer left $1.35 as a tip...Plz help me Which number is a reasonable estimate for 637x35? complete the addition equation that represents the associative property DIRECTIONS: Use this information to answer Parts A, B, and C.A traffic cone has a diameter of 10 inches and a height of 27 inches.Part AFind the volume of the cone. Need answers for #3 please hep Carlitas body is made up of many cells. What is one thing all her cells have in common? Mt.Rainer in Washington,has a higher elevation than Mt.Shasta.The difference between their elevation is 248 feet.What is the elevation of Mt.Rainer? Write an equation and solve . (Plz answer quick) Identify the number of solutions for the equation below: A game store owner buys a Nintendo Switch game for $22.50 and sells it with a 40% mark up. What is the retail price? What is (-3,4) (5,-2) in slope intercept form? How did the use of paper help contribute to the spread of Islam?