(please help me with these)
Draw the figures with the following dimensions. Then, solve for the missing terms.

(please Help Me With These)Draw The Figures With The Following Dimensions. Then, Solve For The Missing

Answers

Answer 1

9514 1404 393

Answer:

V = 125 m³l = 7.5 cm

Step-by-step explanation:

You have not told us the sort of figure you're supposed to draw. If these are cuboids, then their drawings are substantially similar to the one shown in the attachment. Your figures may need to show the units on each of the dimensions.

1. A cube with edge lengths of 5 m has a volume of ...

  V = s³

  V = (5 m)³ = 125 m³

__

2. A cuboid with the given volume and other dimensions has a length of ...

  V = lwh

  675 cm³ = l(9 cm)(10 cm)

  675 cm³/(90 cm²) = l = 7.5 cm . . . . . . . . divide by the coefficient of l

(please Help Me With These)Draw The Figures With The Following Dimensions. Then, Solve For The Missing

Related Questions

Solve the equation for w 5(w-2)+10=2w+6​

Answers

Answer:

w=2

Step-by-step explanation:

See image below:)

Answer:

w = 1/2 or w = 3/6

Step-by-step explanation:

5(w-2) + 10 = 2w + 6

5(w-2) + 10 = 5w + 10 - 10 = 5w (the 5 outside of the bracket multiplies with the digits inside, including the w)

Now you have :   5w = 2w+6

Transfer the 2w to the left side, which would make it negative, therefore

5w - 2w= 6

3w = 6

w = 3/6

or

w = 1/2 (simplified)

help answer please help

Answers

I think the answer is frequency table, but I’m not sure.. make your best guess or try asking other people.

Answer:

The best was to display a set of data with a wide range would be

a histogram.

Step-by-step explanation:

It's a graphical display of bars which will help you measure the central tendency.

Complete the explanation on why it is a good idea to use multiple samples when making comparative inferences about two populations.

It is a good idea to use multiple random samples to see how statistical measure vary among the ————-(different/same) samples.

Answers

272 differ samples that’s the answer

state what additional information is required in order to know that the triangles are congruent for the reason given. NO LINKS!!!!​

Answers

Answer:

  29)  RD≅RS

  30)  KL≅YZ

Step-by-step explanation:

29) SSS means three sides must be congruent. Already sides TD and TS are marked congruent, and we know side TR is congruent to itself by the reflexive property. The third sides, RD and RS must be congruent if you're to use SSS.

__

30) HL means "hypotenuse, leg". The legs KJ and YX are already shown as congruent, so the hypotenuses KL and YZ must be congruent if you're to use HL.

What is the scale factor of this dilation? not drawn to scale

Answers

Answer:

a

Step-by-step explanation:

What did she do wrong ?

Answers

Answer:

She wrongly added the equations

Step-by-step explanation:

Given

[tex]-3x + y = 8[/tex]

[tex]-3x + y = -4[/tex]

Required

Her mistake

The mistake is when she added the equations.

When both equations are added, the result is:

[tex]-3x -3x + y+y=8-4[/tex]

[tex]-6x +2y=4[/tex]

and not

[tex]2y = 4[/tex]

The suggestion to avoid such mistake is for the student to check the appropriate signs of each term before adding/subtracting.

question : Suppose you have VND 100 million to save orspend. If you lend, you will receive 112 million after a year. Inflation is 14% / year.
a. What is the nominal interest rate you get?
b. What is the real interest rate?
c. Should you save or spend that money?
d. Question (c) how will be answered if inflation is 10% / year, nominal interest rates do not change?

Answers

Answer:

Step-by-step explanation:

Here are the population figures of five different cities. 371,265 635,155 226,710 468,920 724,435 What is the difference between the largest population and the smallest population?

Answers

Answer:

497,725

just subtract smallest from largest to get the difference

724,435 - 226,710

Answer:

largest population 724,435Smallest population 226,710


Which graph represents y=3 sqrt x+6- 3?

Answers

Answer:

quadrilateral graph I think if you get the answer please inform me

Answer:

A

Step-by-step explanation:

edge 2023

Which system of equations can be used to find the roots of the equation 4x2 = x3.
ly=-4x²
ly=x²+2x
(y = x² - 4x² + 2x
»
O
ly=0
0
o y
Jy = 4x²
Lva-x-2x
ly=44²
ly=x²+2x
o

Answers

Answer:

The second answer

Y=X³-4X²+2X

Y=0

The system of equations can be used to find the roots of the given equation is y = 4x², y = x³+2x

What is an equation?

An equation is a mathematical statement that is made up of two expressions connected by an equal sign.

For example, 3x – 5 = 16 is an equation.

Given is an equation, 4x² = x³+2x, we need to identify the system of equations can be used to find the roots of this,

An equality can be transformed in a system of equations by making each side equal to a new variable. In this case the variable y was made equal to each side.

See that may find the solution of such system by graphing both functions in a same coordinate system, where the intersection of the functions would show the solution of the system.

The attached image. In such graph, the red curve is the function y = x² and the blue function is y = x³ + 2x.

The intersection point is (0,0) meaning that the solution is x = 0, y = 0.

Hence, the system of equations can be used to find the roots of the given equation is y = 4x², y = x³+2x

Learn more about equations, click;

https://brainly.com/question/29657992

#SPJ7

Find the radius of the sphere with the given volume.

Answers

Answer:

see below

Step-by-step explanation:   6  5  17  43

Volume of a sphere = 121.5 π mm³   Find r

Vol Sphere = (4π r³) / 3     solve for r

Vol Sphere × 3 = (4π r³)

(Vol Sphere × 3) / 4π = r³

∛((Vol Sphere × 3) / 4π)  = r

∛((121.5 π mm³× 3) / 4π)  = r         the pi terms cancel

∛((121.5  mm³× 3) / 4)  = r

∛((364.5  mm³) / 4)  = r

∛((91.125  mm³) )  = r

       4.5   =  r

Determine the value of y, if x is 1.
y = |x| +7

Help plsss

Answers

Answer:

8

Step-by-step explanation:

The absolute value (the lines both sides of x) simply mean the number in between is positive. Since 1 is already positive, just add it to 7!

The answer is 8 yw bjhbb

The company has only two division division eight and division be last year division a made 60% of the companies total revenue and division be made 40% of the total revenue this year division as revenue has decreased by 35% and division bees revenue has decreased by 5% which division had higher revenue this year?

Answers

9514 1404 393

Answer:

  Division A

Step-by-step explanation:

Suppose last year's revenue for the company was 100 units.

Last year's Division A revenue was 0.60×100 = 60. This year's revenue is 1-35% = 65% of last year's, so is ...

  60 × 0.65 = 39 . . . . units

__

Last year's Division B revenue was 0.40×100 = 40. This year's revenue is 1-5% = 95% of last year's, so is ...

  40 × 0.95 = 38 . . . . units

__

At 39 units this year, Division A still has the higher revenue than Division B at 38 units.

Emilia is painting a triangular picture frame. The perimeter is 30 inches. If one side is 13 inches long and another side is 5 inches long, what is the length of the other side of the picture frame?

Answers

Answer:

12 inches

Step-by-step explanation:

30-13=17

17-5= 12

Use information about the triangle's perimeter, to find the side length of C.

If the triangle frame is a right triangle, than you could use the Pythagorean Theorem and use the following formula, a^2 + b^2 = c^2, to find the measure of side c.

Have a great rest of your day, and I hope this helps!

-kiniwih426

Please help a girl out, math is not my forte

Answers

Answer:

80 ft²

Step-by-step explanation:

You are given the formula

a = (1/2)bh

Just plug in the base and height, then multiply

a = (1/2) * 8 *20

a = (1/2) * 160

a = 80 ft²

Answer:

80 [tex]ft^{2}[/tex]

Step-by-step explanation:

Area = [tex]\frac{1}{2} bh[/tex]

Area = [tex]\frac{1}{2}[/tex] 8 · 20

Area = [tex]\frac{1}{2}[/tex] 160

Area = 80 [tex]ft^{2}[/tex]

Round the decimal to the nearest hundreth. If decimal cannot be rounded, state this.

194.59

Answers

the answer is 194.60

The decimal cannot be rounded. It is already rounded to the nearest hundredth.

7) Point P is located at (4,8) on a coordinate plane. Point P will be relfected over y = x. What will bee
the coordiantes of the image of point P?
A. (28,4)
B. 24,8)
C. (4,28)
D. (8,4)

Answers

I think the answer is A 28,4 I hopes this helps

A ramp is in the shape of a triangle

Answers

Nice but what’s the question lol

Answer:

Step-by-step explanation:

The formula for the area of a parallelogram is A = bh, where b is the base and h is the height.

A parallelogram that is not drawn to scale. The height is labeled (x minus 4) centimeters. The base is labeled (2 x squared + 2 x minus 6) centimeters.
Which simplified expression represents the area of the parallelogram?

Answers

Answer:

Area = 2x^3 - 6x^2 - 14x + 24

Step-by-step explanation:

h = x - 4

b = 2x^2 + 2x - 6

Area = b * h

Area = (x - 4)(2x^2 + 2x - 6)                           Multiply through by x

Area = 2x^3 + 2x^2 - 6x - 8x^2 - 8x + 24     Multiply through by -4

Area = 2x^3 + (2x^2 - 8x^2) - 6x - 8x + 24   Collect like terms.

Answer

Area = 2x^3 - 6x^2 - 14x + 24

Answer:

D

Step-by-step explanation:

TEST ON EDGE

round 5763 to the nearest hundred

Answers

Answer:

[tex]5800[/tex]

Step-by-step explanation:

Hope it is helpful...

Answer:

5800

Step-by-step explanation:

5763

7 is in the hundreds place

We look at the tens place to determine how to round

If the tens place is 5 or above we round up, if it is 4 or less- leave it alone

Since 6 is 5 or above, we round the 7 up

5763 rounds to 5800

Levers are not a problem in the mechanical system. But, if you put two different simple machines that do not cooperate, they will be able to make the question that you need to. T or F

Answers

What was that? F maybe

Answer:

True

Step-by-step explanation:

I am assuming that you are asking if two different simple machines that do not cooperate will work or not.

The answer to that is True.

Two things that do not work together will not work together. The two simple machines can not work with each other.

So, the answer is True. Best of Luck!

8. In rural third world countries, farmers use a
conical bucket, the "Gầu Dây” to drain/transfer
water from one rice field to another. If the height
is 20" & the diameter of the opening is 15”, how
much cubic feet of water can two farmers drain
in three hours if their rate is 28 “gầu" per
minute?

Answers

9514 1404 393

Answer:

  6872 cubic feet

Step-by-step explanation:

The volume of the conical bucket is ...

  V = 1/3πr²h

  V = 1/3π(15/2 in)²(20 in) = 375π in³

There are 60 minutes in 1 hour, so 3×60 = 180 minutes in 3 hours.

If each of 2 farmers can transfer 28 buckets per minute the total amount transferred is ...

  (375π in³)(180 min)(2 farmers)(28/min/farmer) = 3,780,000π in³

There are 1728 in³ in 1 ft³, so this is ...

  (3,780,000π/1728) ft³ = 2187.5π ft³, about 6872 cubic feet.

A license plate begins with three letters. If the possible letters are A, B, C, D and E, how many different permutations of these letters can be made if no letter is used more than once?

Answers

Answer:

60 different permutations of these letters can be made.

Step-by-step explanation:

Permutations formula:

The number of possible permutations of x elements from a set of n elements is given by the following formula:

[tex]P_{(n,x)} = \frac{n!}{(n-x)!}[/tex]

How many different permutations of these letters can be made if no letter is used more than once?

3 letters from a set of 5. So

[tex]P_{(5,3)} = \frac{5!}{(5-3)!} = \frac{5!}{2!} = 5*4*3 = 60[/tex]

60 different permutations of these letters can be made.

Which function is graphed on the coordinate plane below?

Answers

Answer:

f(x) = 2x - 6

Step-by-step explanation:

positive slope = 2

y- intercept = -6

Answer:A

Step-by-step explanation:

please help! (listing BRAINLIST and giving points) ​:)​

Answers

Answer:

(a) = 60

(b) = 70

Step-by-step explanation:

(a) Sum of all the angles of a triangle is 180

This is an equilateral Triangle

which means all the sides are equal since all the sides are equal that means all the angles are equal

[tex]x + x + x = 180 \\ 3x = 180 \\ x = \frac{180}{3} \\ x = 60[/tex]

(b) this is an isosceles triangle with two equal sides that means the two opposite angles are equal

[tex]40 + x + x = 180 \\ 40 + 2x = 180 \\ 2x = 180 - 40 \\ 2x = 140 \\ x = 70[/tex]

PLEASE HELP ME!!! I need to simplify these equations, not answer them.

Answers

Answer:

Step-by-step explanation:

a= 2qr^3 quotent 6p^2

Question in in picture, please help

Answers

Step-by-step explanation:

256 mm3

cause volume of rectangular prism is l*b*h

D.256
Because 10x8x3.2= 256

please answer thanks ​

Answers

Answer:

a

Step-by-step explanation:

I believe it is answer a. the helicopter is the distance in the air that it is cruising and the angle is how it has to begin its decent down to the fireman

A is the answer next time use your calulator, but because you asked the answer will be .. a

Write the simplified expression that represents the perimeter of the triangle below.
X - 3
4x + 4
2x + 1
Show Work

Answers

Answer:

Just plus everything together

X-3+4X+4+2X+1

Step-by-step explanation:

Which inequality has the solution shown below?
-18 -17 -16 -15 -14 -13 -12

Answers

Answer:

0.2x+5>2

Step-by-step explanation:

0.2 is the same as 2/10;

(2/10)x>2-5

(2/10)x>-3

2x>-30

X>-15( since -15 is lesser than -14,-13,-12 and so on. the sign should be >

Other Questions
A woman sold an article for 20.00cedis and made a profit of 25%.Find the cost price of the article. What is the sign of -9. (0/-3) If a firm's marginal tax rate is increased, this would, other things held constant, lower the cost of debt used to calculate its WACC. True False When evaluated, which expression has a result that is a rational number? How does convection cause ocean currents?A. During the process of convection, energy is transferred to the atmosphere forming winds. These winds power surface currents.B. During the process of convection, the heating of surface water by the sun results in upwelling.C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.D. During the process of convection, more minerals and gases dissolve in warm water. This increases the density of the warm water and causes it to sink. The angle of elevation to a nearby tree from a point on the ground is measured to be31. How tall is the tree if the point on the ground is 62 feet from the tree? Roundyour answer to the nearest tenth of a foot if necessary. Lighting is the movement of? A business manager finds that the building expense each month is completely uncorrelated with revenue levels. What should the business manager assume about this cost? What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience. how can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededhow can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededOrder the sequence of events in transcription?1- free ribonuleotide triphosphates base-pair with the deoxyribonucleotides in the DNA template 2- RNA polymerase binds to the promoter region of a gene3- primary rna transcript is formed 4- two DNA strands are seperatedWhich organic molecule is not found on the plasma membrane?A. carbohydratesB. cholestrolc. phospholipidsd. proteinsWhat does this statement mean : "Information flow between cells tissues and organs is an essential feature of homeostasis and allows for integration of physiological processes"A. the nervous system is the most prominent body system for integration of physilogical processes B. some substances can affect local processes while others travel to exert their effects on other distant parts of the bodyC. communication between body structures through body fluids is the most important physiological processesD. Neurotransmitters, hormones, paracrine and autocrine substances exert their efferts locally as well as distant body structureswhich statement best describes the orientation the phospholipid molecules in a membrane:A.) the nonpolar fatty acids are oriented towards the cholestrol moleculesB.) the hydrophilic layer is oriented towards the middle of the phosphlipids C.) phospholipids align themselves in the membrane in a bimolecular layerD.) the hydrophobic and hydrophilic structures point away from the cellWhich is NOT a product of glycolysis under aerobic and anaerobic conditions?A.) lactate B.) FADH C.) pyruvate D.) NADH Which reason is why water is an essential nutrient? A.) water needs to move between compartmentsB.)can be obtained through ingestionC.) body cant make enough water for its needsD.) water evaporates from the skin that has the largest surface area among all body structures From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Tia and Sam are partners who solely own T and S Florist. As owners, they can:______.a. claim the organization as their legal property. b. can't sell the company. c. claim only limited liability. d. avoid taking any legal responsibility for T and S. e. decide not to pay a dividend to their stockholders. HELP ASAP 30 POINTS WORTH !!!!! OO The slope of a line is 2. The y-intercept of the line is 6. Which statements accurately describe how to graph the function? Locate the ordered pair (0, 6). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (0, 6). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points. Please help!!!hi,can you please help me with this?thanks can someone answer this please one of the main ways that federal and state courts differ is the process of discovery that is required in each court. true or false? g If the beginning work in process includes 200 units that are 20% complete with respect to conversion and 30% complete with respect to materials. Ending work in process includes 100 units that are 40% complete with respect to conversion and 50% complete with respect to materials. If 1,000 units were started during the period, what are the equivalent units of productions for the period (using the weighted-average method) for conversion