Please don't post invalid question please..!!

What is Science??​

Answers

Answer 1

Answer:

please mark me as brainliest

Please Don't Post Invalid Question Please..!!What Is Science??
Please Don't Post Invalid Question Please..!!What Is Science??
Answer 2

Answer: Good Morning

Science is the intellectual and practical activity encompassing the systematic study of the structure and behaviour of the physical and natural world through observation and experiment.The three main types of science are: physical science, Earth science, and life science. Physical science is the study of inanimate natural objects and the laws that govern them. It includes physics, chemistry and astronomy

Explanation:

Hope it helps! Have a good day


Related Questions

What is an example of a learned behavioral adaptation?
O camouflage
O hunting
O hibernation
O migration

Answers

Answer:

Hunting

Explanation:

Camouflage is a hereditary physical aspect, whereas hibernation and migration are instinctual. Hunting is a learned behavior as it is not as ingrained as the other two and is not automatically done.

P.S. at first I read the answer choices to the tune of "O, christmas tree"

Which one is the true answer

Answers

Answer:
B
Explaination:

The body produces extra white blood cells after it has eliminated an invading organism. What
term is used to describe these "extra" cells?

Answers

The increase in extra cells is called leukocytosis. hope this helps!

Hanan ate a meal that consisted of rice, dal, fish and fried potatoes. Explain the process of digestion of the food with reference to the parts and enzymes involved in the digestive system.

Answers

Answer: A digestive system can be defined as a system which is made up of the alimentary canal and the associated glands and organs which produce some of the enzyme- rich secretions that bring about digestion. The process of digestion of food Hanan are, is discussed below.

Explanation:

The food taken by Hanan consist of carbohydrates (rice, potatoes ), protein( fish, dal) , fats and oil( fish, fried potatoes). The digestion of the food taken passess through a long tube ( alimentary canal) which stretches from the mouth through oesophagus to stomach, intestines and down to the anus.

In the MOUTH, the following occurs:

--> The food is cut and grinded into smaller pieces by the help of the teeth.

--> the enzyme ptyalin acts on the carbohydrate part of the food converting it to complex sugar.

--> the food is mixed with saliva, with the help of the tongue, is rolled into a bolus which is then swallowed.

At the STOMACH, food enters through the peristaltic movements of the oesophagus, The following occurs:

--> The muscular walls of the stomach contract and relax forcefully, thus churning the food.

--> Gastric juice( consists of pepsin, renin and dilute hydrochloric acid). Dilute hydrochloric acid activates pepsinogen to pepsin which digests proteins to polypeptides.

--> Food remains in the stomach for three to four hours. By this time, it is a thick, creamy fluid called chyme which them moves to the duodenum (small intestine).

At the SMALL INTESTINE, digestion occurs at the first part called the duodenum, and later part called the ILEUM.

--> Several substances are secreted into the duodenum from the pancreas( pancreatic juice) and liver( bile), the accessory organs of digestion.

--> pancreatic juice contains three important enzymes whose activities include:

• Amylopsin: Breaks down complex sugar to maltose

• Trypsin: breaks down protein into peptides

• Lipase: Breaks down fat into carboxylic acids and glycerol (end product of digestion of fat).

--> Bile from the liver, adds water to the chyme, emulsifies fat and neutralise the action of dilute hydrochloric.

At the ILEUM, intestinal juice is produced by special cells of the small intestine. Their actions include:

• maltase: this acts on maltose converting it to glucose( which is the end product of carbohydrate digestion).

• erepsin: This acts on peptides converting it to amino acids( which is the end product of protein digestion).

Absorption takes place at the small intestine.

Select the conditions caused by fungi.


rust

yellow mosaic

barley yellow dwarf

blight

Stewart’s wilt

holcus spot

stalk rot

Answers

The answers are the following:
-Rust
- yellow mosaic
- blight
-Stalk rot

—Evidence—
•] Rusts are plant diseases caused by pathogenic fungi of the order Pucciniales.

•] Wheat yellow mosaic (usually called wheat spindle streak mosaic) is caused by a soilborne virus which also is transmitted by the soilborne fungus, Polymyxa graminis.

•] Blight spreads by fungal spores that are carried by insects, wind, water and animals from infected plants, and then deposited on soil. The disease requires moisture to progress, so when dew or rain comes in contact with fungal spores in the soil, they reproduce.

•] Fusarium stalk rot, primarily caused by the fungus Fusarium verticilliodes, is a common disease in the Midwest. This fungus also causes Fusarium ear rot and can infect roots, stalks, and leaf nodes. It is most common in hot, dry years.

Help please need help this is due soon​

Answers

Answer:

2)parastice

4)predation

hope this helps and this is the far I can get

what is formed during photosynthesis​

Answers

Answer:

Glucose and oxygen is produced

Explanation:

oxygen is usually released as a by-product and the glucose made is converted to starch and stored in leaves

plus ATP molecules are formed from excess light energy and is converted to a high energy chemical compound

Write a hypothesis showing the effect of nutrients in the soil on the growth rate of the tomato plant

Answers

Hypothesis:

As the tomato plant grows, nitrogen levels in the soil will decrease

A hypothesis showing the effect of nutrients in the soil on the growth rate of the tomato plant is As the tomato plant grows, nitrogen levels in the soil will decrease.

What is soil ?

The  soil is  a mixture of different components which comprises  minerals, organic matter, and living organisms, it is a loose sediment,  Moreover, there are different types of soil like Clay Soil, Sandy soil, Loamy Soil, Silt Soil

soil  it is One of the most crucial components of the biosphere, this particle is composed of 45% minerals, 50% spaces  and 5% organic matter, the soil involve in  many important functions such as Providing a growth medium for the plants, Acts a modifier of the earth’s atmosphere

The formation of soil involve in different process , it can be formed   by weathering of rocks and the weathering of Solid rock  occur in three way like Mechanical Weathering, Chemical Weathering, Biological Weathering

For more details regarding soil, visit

brainly.com/question/8937689

#SPJ2

cohesion is a property water.Which of the following is NOT an example of cohesion

a.water is attracted to the sides of a glass cylinder
b.water strider can walk on water
c.water forming a drop on a penny
d.water molecules are attracted to each other

Answers

Answer:

A po kasi nga kapag ang tubig ay naisalin sa isang baso minsan ang tubig ay dumidikit sa baso tama diba kaya naman ang sagot ay A baka naman brainliest naman jan:)

Water is attracted to the sides of a glass cylinder is an example of cohesion.

What do you mean by cohesion?

Cohesion means sticking together. If your group of friends heads to the lunchroom as a team and sits all together, you're demonstrating strong cohesion.

Cohesion allows for the development of surface tension, the capacity of a substance to withstand being ruptured when placed under tension or stress.

Cohesion refers to the attraction of molecules for other molecules of the same kind, and water molecules have strong cohesive forces thanks to their ability to form hydrogen bonds with one another.

Learn more about cohesion:

https://brainly.com/question/29598400

#SPJ2

When a blood clot breaks free and blocks a vessel leading to the brain a _______________________ can happen.

Answers

Answer:

a stroke can happen

Explanation:

A stroke can happen, right?

Which of the following improves your range of motion and helps prevent
injuries?
A. A healthy body composition.
B. Strong flexibility,
C. Strong cardio-respiratory endurance.
D. A good sense of balance.
SUBMIT

Answers

Answer:

B. strong flexibility

Explanation:

Being flexible allows your body to move in a fuller range of motion and can help prevent injury because you aren't putting as much strain on yourself.

Approximately time passes between B and F

Answers

Answer:

14 days

Explanation:

It takes 27 days for the moon to make a full rotation around the earth. Because half the of the rotation around the earth has been made, half 27. Half of 27 is 13.5, so the time between B and F is approximately 14 days.

HELP IT DUE NOW !!!!!!!!!!!!!!!
An area that is in the early stages of secondary succession will typically contain

rock lichens.

evergreen trees.

perennial shrubs.

annual grasses.

Answers

Perennial Shrubs I know it is late.

how do you call the collection of organisms that belong to different populations but all live in the same area and interact with one another ​

Answers

Answer:

Ecosystem

Explanation:

Ecosystem is the amount of variation shown by organisms in an ecosystem.

The major goal of the Social Gospel movement in the late 19th and early 20th century was to: Promote the spread of Protestantism in United States territories Promote the spread of Protestantism in United States territories Draw the attention of Protestant churches to the plight of the urban poor Draw the attention of Protestant churches to the plight of the urban poor Encourage support for Charles Darwin's theory of biological evolution Encourage support for Charles Darwin's theory of biological evolution Spread Nativist sentiments

Answers

Answer:

Draw the attention of Protestant churches to the plight of the urban poor.

Explanation:

The main aim and goal of the Social Gospel movement was to bring attention of Protestant churches to the difficult and dangerous solution of the urban poor. The main purpose of this movement is to combat injustice, suffering and poverty in the society. This movement started to solve the social problems such as social injustice, poverty, crime, economic inequality, alcoholism, Racial tensions slums, clean environment and child labor etc. This movement begun in the 20th century and has a great effects on he progressive-minded reformers.

Why are enzymes important for chemical
reactions?

Answers

Answer:

Enzymes greatly increase the reaction rate, or catalyze them.

Explanation:

Without them, many of us would not be alive, because the reactions wouldn't be fast enough!

On the Indonesian island of Bali, about 3/4 of the feral (stray) cats have a stumpy tail while only 1/4 of the cats have a regular long tail. When you did some experiments and picked out a bunch of random stumpy-tailed cats and mated them, they had some stumpy-tailed kittens and some regular-tailed kittens. You did the same with the the regular tailed cats, but they always had only regular tailed kittens. What does this tell you about the genotype of the regular tailed cats

Answers

Answer:

That stumpy tail is the dominant trait, while the regular long tail is the recessive trait.

Explanation:

Due to technical problems, you will find the complete explanation in the attached files

There are 450 calories in 100 g of trail mix. If you burn 30 calories in 10 minutes of walking, how much trail mix should you eat to replenish the energy you spend walking for 2 hours?

Answers

Answer:

to replenish the energy spent walking for 2 hours, 80g of trail mix should be eaten

Explanation:

Firstly, let us calculate the number of calories burnt in 2 hours

in 10 minutes; 30 calories are burnt

∴ in 1 minute 30/10  calories are burnt = 3 calories are burnt

2 hours = 120 minute

∴ in 120 minutes 3 × 120 = 360 calories are burnt.

Next, let us calculate the amount of trail mix that contains 360 calories

100g of trail mix = 450 calories

450 calories = 100 g

1 calory = 100/450

∴ 360 calories = 360 × (100/450)

=  360 × 0.222 = 80g

∴ to replenish the energy spent walking for 2 hours, 80g of trail mix should be eaten

anyone know the answer??????????????????????????????????

Answers

Answer:

The first one is the answer

Explanation:

Kingdom: Animal

Genus: Leucocephalus

Species: Haliaeetus

If the DNA sequence is GCTCAATTCGACCTA, the complementary RNA
sequence created during transcription is

Answers

Answer:

CGAGTTAAGCTGGAT

Explanation:

thymine pairs with adenine and guanine pairs with cytosine

T-A

G-C

Heat energy is the transfer of _______ energy. A. chemical B. thermal C. electrical D. mechanical PLS HELP

Answers

Mechanical I think I’m not sure sorry
B, thermal. Chemical would do more with chemicals (surprise) reacting with each other. Electrical has to do with electrons moving. Mechanical would be due to movement (think of how you’d get sweaty after working out).

Please complete the following DNA strands

1. AGGTCCAAGCTCAAATTTCCCC

2. GAAACCCCTTAAACCTTAATTCC

3. GCGCGCGCAAATTTTTCCCATCT

Please complete the following strands using RNA:

1. AGGTCCCAAAGGCCCTTTCC

2. UAAAGGGCCCAGCCCACC

3. CUAAAAGGGGGUUUUAACC

Answers

1) TCCAGGTTCGAGTTTAAAGGGG
2) CTTTGGGGAATTTGGAATTAAGG
3) CGCGCGCGTTTAAAAAGGGTAGT

1) TCCUGGGTTTCCGGGUUUGG
2) AUUUCCCGGGUCGGGUGG
3) GAUUUUCCCCCAAAAUUGG
(Pretty sure)

1.2 Identify TWO types of stressors that learners are likely to experience in a post-school
destination such as a college or university, or the workplace.

Answers

Answer:

The two types of stressors are;

1. Physical stress

2. Psychological stress

Explanation:

Stress is a state of subjecting a person or thing to different forms of pressure. Stressors are factors that can lead to stress. When a person gets into an institution of higher learning or begins working with an establishment, he can face different kinds of stress. Two of them include;

1. Physical stress: This stress could be caused by excessive exertion in activities. In the school environment, attending lectures, completing assignments, and engaging in social activities could result in burn out.

2. Psychological stress: This stress can be caused by emotional and cognitive factors. Rigorous deadlines and expectations from bosses can lead to emotional drain.

match the following
(i) Stem tuber (a) minerals

(ii) Conditioned Reflex (b) Blue green algae

(iii) Blood Circulation (c) potato

(iv) Pancreas (d) chlorosis

(v) Autotrophs (e) Pavlov's Experiment

(vi) Active transport (f) Insulin

(g) William Harvey​

Answers

Answer:

Stem tuber ---- Potato

Conditioned reflex ---- Pavlov's experiment

Blood circulation ---- William harvey

Pancreas ---- Insulin

Autotrophs ------ Blue green algae

Active transport ---- Minerals

Note: Chlorosis has no matching item in the list. Explanation is given below.

Explanation:

Stem tubers are plants which store their food in their stems. Potatoes are stem tubers.

Conditioned reflex is a reflex is acquired gradually by training in association with specific repeated external stimuli. For example, the Russian psychologist Ivan Pavlov's  performed experiments on conditioned reflex using a dog. He demonstrated that a dog will salivate on the sound of a bell even if there is no food given to it if the ringing of the bell preceded every feeding session of the dog.

William Harvey discovered the circulation of blood and the function of the heart .

The islets of Langerhans found in the Pancreas secretes the hormone, insulin.

Autotrophs are organisms which are able to manufacture their own food, Blue green algae are examples of autotrophs.

Active transport is transport which requires expenditure of energy and occurs against the concentration gradient of the substance being transported. Because the concentration of minerals in the soil are in very low concentration, active transport is used by the root hair cells carrier proteins to move mineral ions across the membrane into the cell against the concentration gradient. ATP hydrolysis provides the energy for this process.

Chlorosis is a disease which appears as the yellowing of leaves in plants and in human a green tinging of the skin which is caused by the deficiency of minerals especially iron and manganese.

Is the thermos considered a conductor or insulator?

Answers

Answer:

no

Explanation:

Insulator is the answer

Can someone help me with his please?

Answers

4N to the left
5N to the left
0N
9N to the right

High levels and long periods of stress can increase a person's risk for many diseases
True
False​

Answers

Answer:

This is true many people can get many diseases from stress.

Answer:

True, go on this for your assessment  I commented on ur other post too, https://quizlet.com/341036936/chapter-11-lesson-3-flash-cards/

Explanation:

What's does the term origin time mean in earth science

Answers

Answer:

Well depending on context it can mean different things, I could mean one of these three thing, choose the one you think is the most suitable,

(1) The birth, existence, or beginning; starting point. (2) The cause; that which causes something to arise. (3) That which acts as the source or that which from where something is derived.

Select the methods and results that best illustrate sustainable crop intensification.


GMO drought-tolerant seeds

low pesticide use

high-yield, low ecological impact

heavy use of irrigation

low cost

high cost

high use of synthetic fertilizer

high labor

Answers

Answer:

GMO drought-tolerant seeds, high use of synthetic fertilizer, high-yield, low ecological impact.

Explanation:

Crop rotation is one of the most powerful techniques of sustainable agriculture. Its purpose is to avoid the consequences that come with planting the same crops in the same soil for years in a row. It helps tackle pest problems, as many pests prefer specific crops.

The diagram below represents the circulation of air above Earth's surface at a coastal location during the day and at night.
This local air movement is best described as an example of
1.
conduction between Earth's surface and the atmosphere above it
2.
condensation of water vapor during the day, and evaporation of water during the night
3.
convection resulting from temperature and pressure differences above land and water
4.
greater radiation from the warmer ocean during the day and from the warmer land at night
Submit Answer

Answers

Answer:

3. convection resulting from temperature and pressure differences above land and water

Explanation:

Due to the the difference between the ability of land and to water to absorb and radiate heat energy, the land gets heated up by the sun more quickly than water during the hot afternoons. As a result, the air above the land surface gets heated up more quickly than that above water. Warm air being less dense than cold air will rise above to atmosphere creating a low pressure area on land. On the other hand, air above water is not heated up as quickly, thus the dense cooler air over water will rush in and replace the warm air that has risen above the land surface.

At night, the land cools off more easily than water, hence the air above the land surface is cooler. On the other, water does not lose heat as quickly as the land, hence the air above the water surface is warmer than that over land. Warm air over the water surface will rise above, while colder air from land will replace it.

Other Questions
Which expression is equivalent to 7 (x y)?1. 7 x + y2. 7 x minus y3. x (7 y)4. StartFraction x y Over 7 EndFraction Desire conducts a survey of all 800 students in her school to find their favorite berry. She graphs the results of the survey the circle graph shown. If the number of students who prefer raspberries doubles, how many students would choose raspberries as their favorite?A) 80 studentsB) 320 studentsC) 40 studentsD) 160 students("My teacher gave a hint: The correct percent (double 20% is 40%) but they want to know what is 40% of the total. Set up a proportion.x 40%_____ = _____800 100Cross multiply and divide to get your answer!") Please tell me how and work!!! :) A linear equation written in the form Ax + By = C is in What is the ability of some creatures to control their body temperatures through internal means such as muscle shivering, fat burning, and panting called?Question 10 options:metabolismendothermicectothemic In an ecosystem, a group of birds eat fruit from a tree. When the birds drop the fruit on the groundthe mice ea the fruit. Seeds are spread around the area by both the birds and mice and new trees grow. What is this an example of ? Fill in the blank in the following sentence with the appropriate noun below. Votre carte orange vous permet de prendre ____ tous les jours.A. un helicoptereB. le metreC. la navette.D. un paquebot There are 4 such boxes containing toffee and mints Mary take 8 toffees and 26 mints from the boxes what is the ratio of the number of toffees to the number of mints The coordinate point E(8,-10) after a dilation with scale factor of 2.5, centered at the origin, becomes the point O (20,-25) O (16, -20) O (10.5, -7.5) O (5.5, -12,5 7m 6m 3mFind rev surface area of each prism 1) What are the pros of distance learning? 2) What are the cons of distance learning? 3) Do you support the use of distance learning for all students? What is the equation for nth term of the geometric sequence-2,8,-32,...? Martin says the area of a tile with a length of 1 foot by a width of 1 foot has an area of 1 square foot. And, to find 1/2 of this area, he would need to find 1/2 of the width and 1/2 of the length, and then multiply those two values. Unfortunately, his method is incorrect. Show at least one equation to show why this method would not work, and briefly state a method that will find 1/2 of 1 square foot.I will mark brainliest if right really need help timed test. Spanishhhhhhh (;`) Popular petitions in history Which of the following is true of women in the 1920s?A) A majority of women attended collegeB) flappers became role models for women of all social strataC) womens political activism declined despite their gain of the right to voteD) most women supported the equal rights amendmentE) The number of women in the medical and legal professions increased Does anyone know this !!! If so answer ASAP Solve the inequality a+4/2>16 help meh I'm doing more stuff for I can get another apple phone and another anonymous mask- Analyze the map below and answer the question that follows. A physical map of Asia. An area in south central Asia between the Arabian Sea and Bay of Bengal is circled in red. Image courtesy of NASA Which South Asian country is circled in red on the map above? A. China B. India C. Russia D. Indonesia Please select the best answer from the choices provided. A B C D