Need help need help need help need help

Need Help Need Help Need Help Need Help

Answers

Answer 1

Answer:

Step-by-step explanation:

I believe that since both circles C & D are congruent, and TU is bisected into TW and WU, PS = 7.4/2 = 3.7

PS = 3.7

Answer 2

Answer:

it is 6.9

Step-by-step explanation:

i took the test


Related Questions


A light bulb consumes 1800 watt-hours per day. How long does it take to consume 8100 watt-hours?

Answers

Answer:

8100/1800 = 4.5 days

Step-by-step explanation:

help m.e please please

Answers

Answer:

(-3, -4)

Step-by-step explanation:

The solution is where the two lines intersect. Therefore, the x-coordinate is -3, and the y-coordinate is -4.

Another way to solve this would be to set the to equations equal to each other, so 2x+2 = -4. Therefore, 2x = -6, and x = -3. And from the second equation, y = -4.

Please help with this

Answers

Answer:

1, 2, 3, 6, 9, 18, 27, 54

Step-by-step explanation:

find the value of x (image below)

Answers

Answer:

x=35

Step-by-step explanation:

Your scores on the first 4 tests in Algebra were 85, 80, 90, and 93. What do you need to make on the 5th test to have a 90 average in the class?

Answers

Answer:

you would have to get a 100 on your fifth test

Step-by-step explanation:

because between your first 4 tests, the average is only 87 something but when you add 100 to that, the average turns to 89.6 which when rounded becomes 90.

Annabella rolls two number cubes, each with sides that are labeled 1 to 6. What is the probability that the first cube shows a one and the second one shows a one?

Answers

2/12 which means 1/6
I hope this is correct

Please help due in 5 minutes

Answers

Answer:

18,24,30

Step-by-step explanation:

hope this helps

Answer:

c

Step-by-step explanation:

because that the hypotenuse 30 adjacent 18 and opposite 24

PLZ, I WILL GIVE BRAINLIEST IF YOU HELPPP!

Answers

1.) 1, 2, 3, 5, 7

2.) 11, 13, 17, 19

For which of the following equations does n = 5?
I. 3n = 15
II. n2 = 25
III. 2n = 32

Answers

Answer:

1) 3n = 15

Step-by-step explanation:

1. 3n=15
15 divided by 3 is 5

!!!!!!!!!!!!!!!!!!!!!

Answers

Answer:

A

Step-by-step explanation:

Answer:

Im gona guess C but im not 100%

Step-by-step explanation:

What is the perimiter of a quadrilateral with verticles at (5,2), (10,2), (5,5), and (10,5)

Answers

Answer:

55

Step-by-step explanation:

Which of the following are equivalent to the expression 9/4(1.75−2 1/4)?

Answers

Answer: -1 1/8 (Decimal: -1.125)

evaluate 4z -5y when z=8 and y=3

Answers

Answer:

17

Step-by-step explanation:

In 4z -5y, substitutte 8 for z and 3 for y, obtaining:

4(8) - 5(3) = 32 - 15 = 17

Answer:

17

Step-by-step explanation:

When you have a  number by its variable you multiple, if you know the value of the variable then you multiply the two numbers together.

4z-5y

when z=8 and y=3

The equation really is

4 times 8 - 5 times 3

4 times 8 is 32

5 times 3 is 15

15-32

15-32= 17

Help me with these questions​

Answers

Answer:

A is the correct Answer

Step-by-step explanation:

hope that helps

Answer:

igual es lo mismo

Step-by-step explanation:

hope that help

The dot plot shows two students’ scores on 12 history quizzes.

Which of the following statements correctly compares the median and the range of their scores?

A. The median of Lolo’s scores is greater that the median of Ami’s scores, and the range of Ami’s scores is greater that the range of Lolo’s scores

B. The medians are equal, and the range of Ami’s scores is greater than the range of Lolo’s scores

C. The medians are equal, and the range of Lolo’s scores is greater than the range of Ami’s scores

D. The median and range of Lolo’s scores are greater than the median and range of Ami’s scores

Answers

Answer:

The correct answer is B

Step-by-step explanation:

Both of their medians are equal and Ami's range is larger than Lolo's range :)

The medians are equal, and the range of Ami’s scores is greater than the range of Lolo’s scores

Option B is the correct answer.

What is median?

It is the middle value of the given set of numbers after arranging the given set of numbers in order.

We have,

Lolo's quiz:

Scores: 12, 13, 13, 14, 14, 14, 15, 16, 16, 17, 17, 19

Median.

= (14 + 15)/2

= 14.5

Range,

= 19 - 12

= 7

Ami's score:

Scores: 10, 12, 12, 13, 13, 14, 15, 16, 17, 17, 18, 18

Median.

= (14 + 15)/2

= 14.5

Range.

= 18 - 10

= 8

We can say that,

The median is the same for both and Ami's range is greater than Lolo's.

Thus,

The medians are equal, and the range of Ami’s scores is greater than the range of Lolo’s scores

Learn more about median here:

https://brainly.com/question/28060453

#SPJ2

Robert has x books. Marie has twice as many books as Robert has. Together they have 18 books. Which of the following equations can be used to find the number of books that Robert has? Choose one multiple choice answer
x+2=18
x+x+2=18
x+2x=18
2x=18

Answers

Answer:

the answer: x+2x=18

Step-by-step explanation:

29 thanks and no links or you get reported

Answers

Answer:

$480.11 (C)

Step-by-step explanation:

$575.26 - $95.15 = $480.11

I suck at math
The math problem is below

Answers

Answer:

Brooklyn earns four more dollars than Anna does each hour.

Step-by-step explanation:

So basically in order to get the amount ech of them recieve you would have to divide. So for Anna's since her least given number is 10 hours you would divide how much she earns (256) by how many hours she has been working (10) and you get 25.6

Now for Brooke she is given only one piece of evidence so you would use that she has been working for 26 hours and earns 769.6. So divide her earning by the hour and get 29.6

Subtract each of the answers (29.6-25.6) and you would get 4

Sorry if it doesn't make sense I was trynna rush and give you the answer

Answer:

Brooklyn earns four more dollars than Anna does each hour.

Step-by-step explanation:

6
There are 20 sweets in a bag.
Seven of them are strawberry.
A sweet is taken at random from the bag.
What is the probability that the sweet taken is not strawberry?

Answers

7 of the sweets in the bag are strawberry. Since there are 20 sweets total in the bag, 20 - 7 = 13 sweets in the bag must be non-strawberry.

The probability that a sweet taken at random from the bag is not strawberry would thus be 13/20.

Gina is building a rectangular prism out of sugar cubes for her art class project. She started by drawing a diagram of the rectangular prism that is 4 cubes high, 4 cubes long and 2 cubes wide. How many cubes does she use to make the prism?

Answers

The rectangular prism is made up of the dimensions

Lenght = 4 cubes

Width = 2 cubes

Height = 4 cubes

The total number of cubes she needs shall be derived as number of cubes along the lenght multiplied by number of cubes along the width, and then multiplied by number of cubes along the height. Therefore, she would have:

[tex]volume = l \times w \times h \\ volume \: = 4 \times 2 \times 4 \\ volume = 32 \: cubes[/tex]

Therefore, She need 32 cubes to make the prism.

The sequence 18, 9, 9/2, 9/4, 9/8, ... represents the percentage of votes a particular political candidate has according to polls each day after a scandal. The sequence has a common

Answers

Answer:

r = 1/2

Step-by-step explanation:

Given sequence:

18, 9, 9/2, 9/4, 9/8, ...

We can see this is a GP and its common ratio is:

r = 9/8 ÷ 9/4 = 9/4 ÷ 9/2 = 9/2 ÷ 9 = 9 ÷ 18 = 1/2

Common ratio

9/18=1/29/2/9=1/29/4/9/2=1/2

Common ratio is 1/2

BRAINLIEST FOR CORRECT ANSWER!
What is the transformation rule for a translation 3 units right?

Answers

Answer:Translation happens when we move the image without changing anything in it. ...

Rotation is when we rotate the image by a certain degree. ...

Reflection is when we flip the image along a line (the mirror line). ...

Dilation is when the size of an image is increased or decreased without changing its shape.

True or false: The following table is linear.

Answers

The table is linear because it goes up at a consistent rate each time.

Find the missing side. Round to the nearest tenth.

Answers

150 is your answer,hope it helped

Like what that guy said sorry did not mean to disturb

What is the answer :>

Answers

um.. it’s just a black picture. :>

A trapezoid with a height of 8 ft base measuring 11 ft has an area of 112ft find the length of the other base

Answers

Answer:

1.27272727273 I think

Step-by-step explanation:

The circumference of the inner circle is 270.04 miles. What is the area of the shaded region?

Answers

area of a circle = [tex]\pi r^{2}[/tex]

circumference =[tex]2\pi r[/tex]

Okay so the center of the circle is the same for both of the circles lets take that value as m so the radius of the inner circle is 54 - m

we have the circumference of the inner circle which is 270.04 we can find the value of m using that

[tex]270.04=2\pi (54-m)\\270.04= 339.2-6.28m \\6.28m = 339.2-270.04\\m= 11.02[/tex]

the radius of the inner circle is therefore 42.98

and the full circle has a radius off 65.02

area of shaded region = area of full circle - area of inner circle

area of shaded region = [tex]\pi (65.02)^{2} - \pi (42.98)^{2}[/tex]

area of shaded region = [tex]13281.39 - 5803.4[/tex]

area of shaded region = 7478 rounded off to the nearest whole number

I don't get it please help it's for math ASAP please help

Answers

X>6 it makes me type longer but yea hope it helps

Janea bought a motorcycle for dollars. It depreciates by a factor of each year. Which expression best predicts the value of the car after 10 years?

Answers

Answer:

m·n¹⁰

Step-by-step explanation:

Required equation is in the form of:

V(t) = P*r^t, V- future value, P- present value, r- rate, t- time

In terms of this question:

m·n¹⁰ is the correct choice

Find the volume of the cylinder. Round your answer to the nearest hundredth.

Answers

9514 1404 393

Answer:

  1763.01 m³

Step-by-step explanation:

The height of the cylinder will be ...

  h = (18 m)sin(60°) = 9√3 m

The volume of the cylinder is ...

  V = Bh

where B is the area of the end circle.

  B = πr² = π(6 m)² = 36π m²

Then ...

  V = (36π m²)(9√3 m) ≈ 1763.01 m³

The volume of the cylinder is about 1763.01 m³.

Other Questions
What river connects the Great Lakes to the Atlantic Ocean? View the work of art and answer the questions below.The work above is typically known by the name of its location. What is the name of the structure where the work be found? Who created it? PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! What is correct regarding trans fatty acids hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? what is (-10,10) if i dilate it by 1/2 a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. HELP! Ill mark you brainliest! Find the area of the irregular figure. who tryna be my babymomma? 4) To drink something all at onceA) To down itB) Take a shotC) To out itD) To swallow it Why would an investor want to choose a certificate of deposit over a corporate bond How have voting rights expanded over time? (think about the groups of people and the 6% we originally started at)