Kenya is unsure how to spell the respiratory system term that means “normal breathing.” How should she spell it?

eupnea
epnia
hypopnea
hyponia

Answers

Answer 1
Answer : eupnea

Hope this helps
Answer 2

Answer:

A. eupnea

Explanation:


Related Questions

Traditional medicines derived from the roots of nut-grass (Cyperus rotundus) have been used to treat a variety of ailments, including blood disorders and leprosy. Compound A is the active component in these medicines derived from nut-grass. A synthetic method for making compound A includes an intramolecular SN1 reaction to form a new ring. Identify (circle it) which of two possible starting materials is a better candidate and justify your choice.

Answers

Answer:

yep

Explanation:

Topic Test

The rationale for twin studies is that twins do not normally develop under similar environments.

Please select the best answer from the choices provided

a. T
b. F​

Answers

Answer:

B. False

Explanation:

I calculated it logically

Other Questions
PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! When McCandless is working for Wayne Westerberg in Carthage, South Dakota, Westerberg thinks that McCandlessA.is lazyB.is addicted to drugsC.is probably mentally illD.is one of the hardest workers he has ever seenE.is a genius and an artist What is correct regarding trans fatty acids Choose two or three of the characteristics of successful organizations discussed in this article that you feel are the most important and, using specific examples, explain why you feel that way. (Site 1) hi can you please help me with my work When identifying the agent responsible for causing a disease, why is evaluation of colony morphology not enough? Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. Mason wants to play with Maliyah's Doll House, but first he needs to stop at the clubhouse. If allthree stops are in the shape of a triangle, which of the following distances would NOT be an option? The sum of three consecutive integers is -27 what is the product of the smallest and largest of the three integers? what is the mRNA in TACCGGATGCCAGATCAAATC? what is (-10,10) if i dilate it by 1/2 a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. HELP MEEE BRAINLIEST Clasifica cada uno de los siguientes incisos como sustancia pura (elemento y compuesto) o mezcla (homognea y heterognea). Explica brevemente. (a) arroz con leche (b) agua de mar (c) magnesio (d) gasolina Lines a and b are parallel. The slope of line b is 1/3 . What is the slope of line a?