justify the need of present constitution ​

Answers

Answer 1
What does this mean?

Related Questions

In the 1780s, all of the following were problems facing the new nation except

1. The new president was a tyrant

2. There were intense divisions among the different states

3. The national government of the United States was too weak

4. The new nation struggled with a large war dept

Answers

Answer:

Option 1

Explanation:

The major problem prevailing in the nation during the 1780s were as follows

a) There was  economic and foreign policy problems which caused  huge debt arising out of Revolutionary War and paper money

b) There were discussion going on delegation of power of the federal government or the states which led to intense divisions among the different states

c) The national government too was struggling because of the - a) state court system, b) Unstable state government and c) Powerless Congress unable to help anyone.

Hence, option 1 is correct

1. Harry Truman was the president of

A United Kingdom
B United States
C Canada
D United States
PLEASE HELP ASAP

Answers

Answer:

uk

Explanation:

Answer:

B) United States

D) United States

Explanation:

Harry Truman was the 33rd United States president.

Hope it helps!!!

Why is civilization important?

Answers

Answer:

Civilization describes a complex way of life that came about as people began to develop networks of urban settlements. 

it describes the way of life

What are the Traditional American Values? Explain each of them

Answers

Answer:

Individual Freedom and Self-Reliance

Equality of Opportunity and Competition

The American Dream and Hard Work

Explanation: Individual freedom is basically the freedom to do whatever you want to do as long as it is legal.

Self Reliance is being able to take care of ourselves and be independent

Equality of Opportunity is basically everyone has the same chance at opportunity.

Competition is basically competing for that opportunity

The american dream is basically the opportunity for a better life and living standards

And hard work is the price for the american dream

True or false China and the Soviet Union were allied against the US.

Answers

I think it WAS true but didn't they stop being allies?

good luck its a 50/50 chance:,) sorry

Answer:

Full diplomatic relations between both the US and the USSR were established in 1933, late due to the countries' mutual hostility. During World War II, both the USSR and the United States were briefly allies.

In 1950, Mao and Stalin safeguarded the national interests of China and the Soviet Union with the Treaty of Friendship, and Alliance and Mutual Assistance. The treaty improved the two country's geopolitical relationship on political, military and economic levels. Stalin's largesse to Mao included a loan for $300 million; military aid, should Japan attack the PRC; the transfer of the Chinese Eastern Railway in Manchuria, Port Arthur and Dalian to Chinese control. In return, the PRC recognized the independence of the Mongolian People's Republic.

Despite the favourable terms, the treaty of socialist friendship included the PRC to the geopolitical hegemony of the USSR, but unlike the governments of the Soviet satellite states in Eastern Europe, the USSR did not control Mao's government. In six years, the great differences between the Soviet and the Chinese interpretations and applications of Marxism–Leninism voided the Sino-Soviet Treaty of Friendship.

In 1958, guided by Soviet economists, the PRC applied the USSR's model of planned economy, which gave first priority to the development of heavy industry, and second priority to the production of consumer goods. Later, ignoring the guidance of technical advisors, Mao launched the Great Leap Forward to transform agrarian China into an industrialized country with disastrous results for people and land. Mao's unrealistic goals for agricultural production went unfulfilled because of poor planning and realization, which aggravated rural starvation and increased the number of deaths caused by the Great Chinese Famine, which resulted from three years of drought and poor weather.

There was a whole lot of Anti-Capitalist propoganda going on around this time, so yes, they were allied against the United States of America

The Supreme Court agreed with the Cherokee and in the case of Worcester v. Georgia said the
Natives did not have to go and that it was wrong to take their lands. How did Jackson react?

Answers

Answer: president Andrew Jackson refused to enforce the ruling which later lead to trail of tears

Explanation:

Kevin and James are regular patrons at the King's Arms pub. Kevin has a different favorite hockey team than James. James is easily provoked to severe anger, and often threatens to beat Kevin up during discussions about hockey. One day, Kevin comes into the pub wearing his favorite team's hockey jersey. When James sees the jersey he becomes very angry and forcefully punches Kevin in the arm. A few nights later, James throws a cup of hot coffee on Kevin resulting in severe burns to Kevin's arms. What type of tort has James committed

Answers

Answer:

The right approach is "Intentional Tort".

Explanation:

A tort that could be a civil mistake that takes place whenever an offender commits an intentional act that makes it dangerous to such a third party, is termed as Intentional tort.Across more cases, James deliberately pushed on Kevin either threw warm coffee or chocolate drinks, as well as tried to injure Kevin.

help help help help help help help help help help

Answers

Answer: Decomposers get nutrients and energy by breaking down dead organisms and animal wastes. Through this process, decomposers release nutrients, such as carbon and nitrogen, back into the environment. These nutrients are recycled back into the ecosystem so that the producers can use them

Explanation:

Check numbers 1, 3, and 4

Please help (no links)

Answers

Answer:

Foreign policy goals include the following:

Preserving the national security of the United States.

Promoting world peace and a secure global environment.

Maintaining a balance of power among nations.

Working with allies to solve international problems.

Promoting democratic values and human rights.

Explanation:

"The early mill girls were of different ages. Some were not over ten years old; a few were in middle life, but the majority were between the ages of sixteen and twenty five. The very young girls were called 'doffers.' They 'doffed,' or took off, the full bobbins from the spinning frames, and replaced them with empty ones. These mites worked about fifteen minutes every hour and the rest of the time was their own. When the overseer was kind they were allowed to read, knit, or go outside the millyard to play. They were paid two dollars a week. The working hours of all the girls extended from five o'clock in the morning until seven in the evening, with one half hour each, for breakfast and dinner. Even the doffers were forced to be on duty nearly fourteen hours a day. This was the greatest hardship in the lives of these children. Several years later a ten hour law was passed, but not until long after some of these little doffers were old enough to appear before the legislative committee on the subject, and plead, by their presence, for a reduction of the hours of labor.

—from Lowell Mill Girls,

by Harriet Robinson

Use the primary source above to answer the following - Explain working conditions for young girls in the factories.

Answers

Answer and Explanation:

According to the passage, young girls had to be on duty for about 14 hours a day, even if they were not actually working all of that time. Even though money was worth more back then, they were still paid very little - only 2 dollars a week. The very young girls, who had some time to spare, needed to rely on the kindness of the overseer to be able to use their free time to go play, to knit, or to read. As we can infer, there was no concern about employing children instead of sending them to school. The girls clearly could not study much if they were on duty throughout the day.

Medicolegal does NOT describe the career of a _____.


medical examiner

forensic pathologist

forensic pathology lab technician

coroner

Answers

Answer:

a medical examiner

Explanation:

Answer:

Medicolegal does NOT describe the career of a _____.

forensic pathologistmedical examinercoroner <<<<CORRECTforensic pathology lab technician

Explanation:

I used the answer by the other person ^^^^ it was wrong. The test showed that Coroner was the correct test answer on EDGE 2022

four main towns along the genesis route​

Answers

Answer:

The main four towns along the this route are the towns of Barberton , Badplaas , the agricultural community of Low's Creek and Mbombela .

Explanation:

<33

5. Explain the effect of comparing the end of Plessyv. Ferguson to a death (Paragraph 2)? Cite
evidence from the text in your response.
PLEASE HELP ME

Answers

Answer:

Home

Politics, Law & Government

Law, Crime & Punishment

Plessy v. Ferguson

law case [1896]

WRITTEN BY

Brian Duignan

Brian Duignan is a senior editor at Encyclopædia Britannica. His subject areas include philosophy, law, social science, politics, political theory, and religion.

See Article History

Plessy v. Ferguson, legal case in which the U.S. Supreme Court, on May 18, 1896, by a seven-to-one majority (one justice did not participate), advanced the controversial “separate but equal” doctrine for assessing the constitutionality of racial segregation laws. Plessy v. Ferguson was the first major inquiry into the meaning of the Fourteenth Amendment’s (1868) equal-protection clause, which prohibits the states from denying “equal protection of the laws” to any person within their jurisdictions. Although the majority opinion did not contain the phrase “separate but equal,” it gave constitutional sanction to laws designed to achieve racial segregation by means of separate and supposedly equal public facilities and services for African Americans and whites. It served as a controlling judicial precedent until it was overturned by the Supreme Court in Brown v. Board of Education of Topeka (1954).

What was the specific event or events that led to the 13 original colonies being brought into the United States.

Answers

Answer:

England had signed a peace treaty with Spain, and was now looking westward to establish colonies along the northeastern seaboard of North America. Word was that the Spanish had found “mountains of gold” in this new land, so these voyagers were intent on finding riches as well as a sea route to Asia

Explanation:

England !!!!!’nn!!!!!!!!

1- He's always so .............. I wish he'd relax a bit.

2- It’s the sort of hotel where you’re expected to ................. for dinner.

Answers

Answer:

1. He's always so hard working. I wish he'd relax a bit.

2. It’s the sort of hotel where you’re expected to go for dinner.

hope my ans helps

be sure to follow me

stay safe

have a good day

Explain the historical context for the development of the events in Post-World War II Germany.

Answers

Answer:

Germany After the War

The numbers tell the story of a nation in disarray. Industrial output was down by a third. The country's housing stock was reduced by 20%. Food production was half the level it was before the start of the war.

Henry Hudson is best known for exploring

Answers

Answer:

The correct answer is -  northeastern North America (present-day Canada and parts of the northeastern US).

Explanation:

Henry Hudson was a British sailor during the 17th century who had explored northeastern North America in search of the northeastern and northwest passage to Asia or more of India.

He had two failed explorations but in his third attempt of finding the northwest passage to India, he found northeastern America (New York) and bay (Hudson river named after him).

1. According to the results of your study, what increases with
greater stress?
O A. Optimal health measures
B. Risk of heart disease
C. Emotional wellness
D. Brain fitness

Answers

The answer is B: risk of heart disease

1. According to the results of your study, The risk of heart disease does increases with greater stress.

Stress is simply known as a feeling of emotional or physical anxiety.

It is caused by event or thought that makes an individual to feel frustrated, angry, or nervous.

It is the body's reaction to a obstacles or demand. The three main types of stress are acute, episodic acute, and chronic stress.

Heart disease is a known potential stress-related problem because stress does result to high blood pressure, which can pose a risk for heart attack and stroke.

Learn more from

https://brainly.com/question/19106923

what happened to sarah after arriving in virginia city montana​

Answers

Answer:

what happened to sarah after arriving in virginia city montana

in a direct democracy who votes on government policy​

Answers

Answer:

The 3 branches they get passed on through each one

Explanation:

In direct democracy, people decide on policies without any intermediary.

In a quick write, decide if the United States was justified in dropping the two atomic bombs on Japan in 1945. Take a
stance and make a claim

Answers

Answer:

Look Below

Explanation:

No. The dropping of the atomic bomb on Hiroshima was justified at the time as being moral – in order to bring about a more rapid victory and prevent the deaths of more Americans. However, it was clearly not moral to use this weapon knowing that it would kill civilians and destroy the urban milieu.

what is American culture

Answers

Answer:

American culture encompasses the customs and traditions of the United States. ... The United States is sometimes described as a "melting pot" in which different cultures have contributed their own distinct "flavors" to American culture.

Explanation:

why the chicken wing was a good model to use to explore bone and muscle structures

Answers

The purpose of this lab was to investigate and observe a chicken wing to learn about the parts of a chicken wing, how these parts, like bones, muscles and tendons, work together and how that translates into movement. We dissected the chicken, moved around parts internally and got a brief glimpse into how dissection actually works.

which option best completes the diagram

Answers

Answer:

The boss argues that the article is libel.

Explanation:

Libel is not protected speech.

It’s a because libel is another word for slander

List down two political problems that our country Philippines is continually facing,and propose resolution to the identified problem.​

Answers

Answer:

MANILA, Philippines — The country's heroes faced foreign colonizers centuries ago, but Filipinos now are facing “modern problems” such as poverty, corruption, environmental degradation, terrorism, criminality, and illegal drugs

Insecurely attached infants are those who respond to their mothers with either Select one: a. egocentrism or empathy. b. anxiety or avoidance. c. conservation or basic trust. d. assimilation or accommodation.

Answers

Answer: b. anxiety or avoidance.

Explanation:

Infants which do not find their parents reliable for their care are insecurely attached infants. They experience unpredictable behavior of their parents for example they may receive rewards for their bad deeds or may receive punishment for their good deeds. They do not like to be with either of their parents. Such infants also refuse interactions with people other than parents too, they try to avoid people and perform their own activity, they do not show involvement with others, they feel fear, show anxiety and anger when they are surrounded by their parents or any other person. They experience stress and emotional disturbance.

what does legalism mean in a vocab sentence

Answers

Answer:

strict, literal, or excessive conformity to the law or to a religious or moral code.

Explanation:

i found this at https://useenglishwords.com/legalism

Answer:

1 : strict, literal, or excessive conformity to the law or to a religious or moral code the institutionalized legalism that restricts free choice. 2 : a legal term or rule

the different between probation and parole

Answers

An offender on probation remains under court supervision and must adhere to strict rules throughout the probation term or risk going behind bars after all. Parole is a conditional release from prison and his overseen by the state's correctional system

How does the narrator help the reader understand Ruth's personality?

Answers

Answer:

i belive the answer is c :}

Explanation:

Humans can accurately recognize a smile from a greater distance than they can other facial expressions of emotion. One explanation for this finding is that being able to predict, accurately and quickly, that an approaching person has good intentions contributed to the development of cooperation among humans and the development of society. On which perspective in psychology is this explanation based

Answers

Answer:

The correct answer is - Evolutionary psychology.

Explanation:

Evolutionary psychology is a hypothetical methodology in the social and behavioral sciences, that is used to study mental structure development from an advanced evolutionary aspect. It helps in identifying and differentiate which human psychological qualities are beneficiary of evolutionary choices.

Smile and other facial expressions are helpful in the advanced development of the useful result of such psychological and evolutionary choices.

Other Questions
Fort Sumter is best remembered as...Select one:...the first battle of the Civil War....the final battle of the Civil War....the turning point of the Civil War. Kevin and James are regular patrons at the King's Arms pub. Kevin has a different favorite hockey team than James. James is easily provoked to severe anger, and often threatens to beat Kevin up during discussions about hockey. One day, Kevin comes into the pub wearing his favorite team's hockey jersey. When James sees the jersey he becomes very angry and forcefully punches Kevin in the arm. A few nights later, James throws a cup of hot coffee on Kevin resulting in severe burns to Kevin's arms. What type of tort has James committed HELP PLEASE, ITS URGENT four main towns along the genesis route Michael bought three baseballs from a sports store. Each baseball cost the same amount. The total cost was $8.37. If C represents the cost of each baseball, which of the following statements are true? Select all that applyThe value of c can be found using the formula 30+837The value of c can be found using the formula C/8.37 = 3Each baseball cost $25.11Each boseball cost $279 Need help ASAP giving away 15 points will mark brainlyist as well A phase change is when a substance changes from one state of mind to nother because of the adding or removal of thermal energyTrueFalse pleaase help withhh tthis Please Answer! I will give brainiest. The Picture is down below :)Thank You! EXERCISE 1 IMAGINE YOU ARE A CHILD AT SCHOOL .WRITE A DIARY ENTRY IN ABOUT 150-200 WORDS ABOUT YOUR EMOTIONS THE DAY BEFORE YOUR SCHOOL TAKES YOU TO A THEME PARK Please answer these questions and I swear I will give you brainlist I promise I will answer this question part a and part b please What is the length of the missing leg?45 and 36 Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air