Is this a function?
A) yes
B) No

Is This A Function?A) Yes B) No

Answers

Answer 1

Answer:

yes

Step-by-step explanation:

Answer 2

Answer:

i think it would be No

Step-by-step explanation:

hope this helps!

sorry if wrong


Related Questions

You and your friend each have a canvas of the same size. You divide your canvas into 5 sections and paint 3 of them. Your friend divides her canvas into 7 sections and paints 4 of them. Who paints more?

Answers

The one one paints 3/5, you would find a common denominator and it would be 21/35 and 20/35 so “you”

The person who paints more is given by the inequality equation 3/5 >  4/7

What is an Inequality Equation?

Inequalities are the mathematical expressions in which both sides are not equal. In inequality, unlike in equations, we compare two values. The equal sign in between is replaced by less than (or less than or equal to), greater than (or greater than or equal to), or not equal to sign.

In an inequality, the two expressions are not necessarily equal which is indicated by the symbols: >, <, ≤ or ≥.

Given data ,

Let the inequality equation be represented as A

Now , the value of A is

Substituting the values in the equation , we get

Let the number of canvas be 35 ( LCM of 5 and 7 )

Now , when you divide 35 into 5 sections and paints 3 of them ,

The fraction A = 3/5

And , when your friend divide 35 into 7 sections and paints 4 of them

The fraction B = 4/7

And , the inequality equation is A > B

Substituting the values in the equation , we get

3/5 > 4/7

Hence , the one who paints more is you with 3/5 of the canvas

To learn more about inequality equations click :

https://brainly.com/question/11897796

#SPJ2

8 cm x 10 cm x 17 cm
This figure consists of a rectangle and a quarter circle
What is the perimeter of this figure?
Use 3.14 for pi.

Answers

Answer: 2length plus 2breath circle is 2pie r

Step-by-step explanation:

perimeter of a rectangle is 2L + 2 B a

what is the volume of the cylinder below?

Answers

=2448pie
V=hxpiex r^2
V=17x (12)^2x pie
V=2448 pie

Answer:

B. 2488π

Step-by-step explanation:

Formula: πr2h

π x 12^2 x 17 = π x 144 x 17 = 2488π

Which equation represents the line that is perpendicular to y=1/6 & passes through (-8,-2)?
a) y = -6
b) y = -8
c) x = -8
d) x = -2

Answers

Answer:

x = -8

Step-by-step explanation:

slope of y = 1/6 is zero

the negative reciprocal of zero is considered to be 'undefined', which is the slope of x=-8 (or x = 'any number')

I need quick help. Ill try to give brainliest (since it depends on the amount of people that answer)

Answers

Answer:

The answer should be option B

Someone help me please and no links!!!!! find the value of x

Answers

Answer:

x = 15

Step-by-step explanation:

37*2 = 74

360-74 = 286

286 = 2(9x + 8)

143 = 9x+8

135 = 9x

15 = x

y=21(0.97)^x
please help me​

Answers

Answer:

y=[tex]\frac{21*97^x}{100^x}[/tex], x= all real numbers

A circle is centered at the point (-7,-1) and passes through the point (8, 7). The radius of the circle is ___ units. The point (-15, __ ) lies on this circle

Answers

Answer:

(x + 7)2 + (y + 1)2 = r2.

To get we use point (8, 7): (8 + 7)2 + (7 + 1)2 = r2, r2 = 225 + 64 = 289 = 172.

So, equation of circle: (x + 7)2 + (y + 1)2 = 289

Step-by-step explanation:

Salma and Jared each threw 5 darts at the target shown. Salma scored 19 points by landing 2 darts in A and 3 in B. Jared scored 17 points by landing 1 dart in A and 4 in B. How many points are given for a dart landing in A?

Answers

Answer:

5

Step-by-step explanation:

this can be solved using simultaneous equation

2a + 3b = 19  equation 1

1a + 4b = 17    equation 2

Multiply equation 2 by 2

2a + 8b = 34  equation 3

Subtract equation 1 from 3

5b = 15

b = 3

Substitute for b in equation 1

2a + 3(3) = 19

2a = 9 = 19

2a = 10

a = 5

Answer:

Step-by-step explanation:

2a + 3b = 19 equation 1

1a + 4b = 17 equation 2

Multiply equation 2 by 2

2a + 8b = 34 equation 3

Subtract equation 1 from 3

5b = 15

b = 3

Substitute for b in equation 1

2a + 3(3) = 19

2a = 9 = 19

2a = 10

a = 5

Simplify the following expression by combining like terms: *
-2g - 8 +5g - 5

Answers

Answer:

3g -13

Step-by-step explanation:

If we do a refection of an image followed by translation, the figure will NOT be in the
same final location if we did the translation first then reflection.

True

False

Answers

I think it’s true because reflection flips it to the other side and a translation moves it.

Change this fraction into a decimal: 80/100

.8


.08


8.0

.008




will give brainlist!!!

Answers

Answer:

0.8

Step-by-step explanation:

80 divided by 100 = .8 or 0.8

Find the solution to the system of equations.
x + 3y = 4
2x + 5y = 12
A. (3.8)
B. (-8,4)
C. (16,-4)
D. (1.2)
E. (-1,-2)

Answers

Answer:

C (16,-4)

Step-by-step explanation:

16+3*-4=4

16+(-12)=4

16-12=4

4=4

2*16+5*-4=12

32+(-20)=12

32-20=12

12=12

Find the volume of a pyramid with a square base, where the area of the base is
13.2 cm² and the height of the pyramid is 13.7 cm. Round your answer to the
nearest tenth of a cubic centimeter.

Answers

Answer:60.3cm^3

Step-by-step explanation:

i got it wrong and that was the answer lol

The equation of the function is Y=4x+5.Find the value of y when
x=3
x=-2

Answers

Question:-

The equation of the function is y = 4x + 5. Find the value of y when

x = 3

x = -2

Answer:-

Given:-

y = 4x + 5 [Equation]

To Find:-

The value of y when x = 3 , x = -2

Solution:-

y = 4x + 5 [Given equation]

[tex] \therefore [/tex] When x = 3 ,

y = 4 × 3 + 5 [Value of x is 3]

y = 12 + 5

y = 17 [Answer]

Again, when x = -2 ,

y = 4 × (-2) + 5 [Value of x is -2]

y = -8 + 5

y = -3 [Answer]

Four out of 25 people are left-handed. In a school of 400 people, how many would you expect to be
left-handed

Answers

Answer:

devide the 25 out of 400 and then devide what is left and then... u get the answer

Step-by-step explanation:

Answer:

64 would be left handed

Step-by-step explanation:

16 times 4 is 64

rotate the given triangle 180° counterclockwise about the origin. Help!!!!​

Answers

Answer: (read vertically) [0,0/3,-1/-5,-2]

Step-by-step explanation:

[-1, 0] times [0, -3, 5]

[0, -1] [0, 1, 2]

hopefully this makes sense.

The rotated triangle by 180° counterclockwise about the origin is [tex]\left[\begin{array}{ccc}0&3&-5\\0&-1&-2\end{array}\right][/tex]

How to rotate the triangle?

The coordinates of the triangle are given as:

[tex]\left[\begin{array}{ccc}0&-3&5\\0&1&2\end{array}\right][/tex]

The rotation is given as:

180° counterclockwise about the origin.

The rule of 180° counterclockwise about the origin is:

(x,y) ⇒ (-x,-y)

Using the above rule, we have:

[tex]\left[\begin{array}{ccc}0&3&-5\\0&-1&-2\end{array}\right][/tex]

Hence, the rotated triangle is [tex]\left[\begin{array}{ccc}0&3&-5\\0&-1&-2\end{array}\right][/tex]

Read more about rotation at

https://brainly.com/question/16691874

#SPJ6

Which statement explains the difference between the graphs of f(x) = 4x^2 and g(x) = -8x^2 ?

A) The graph of g(x) is obtained by flipping f(x) over the y-axis and stretching vertically by a factor of 2.

B) The graph of g(x) is obtained by flipping f(x) over the x-axis and compressing vertically by a factor of 2.

C) The graph of g(x) is obtained by flipping f(x) over the x-axis and stretching vertically by a factor of 2.

D) The graph of f(x) is obtained by flipping g(x) over the y-axis and compressing vertically by a factor of 2.

Answers

Answer:

I think C is best explains

The correct option is B.

The graph of g(x) is obtained by flipping f(x) over the x-axis and compressing vertically by a factor of 2.

What is transformation?

Transformation means to change. Hence, a geometric transformation would mean to make some changes in any given geometric shape.

Given are two functions f(x) = 4x² and g(x) = -8x², we need to see the transformation done in the function f(x) to give g(x).

So,

We can see that there is scale factor of 2, because it was 4 in f(x) and in g(x) it became -8 that means the graph have been compressing vertically by 2 units.

Also, the presence of minus sign, this is because the reflection has been done here about x-axis, so it becomes -8x².

According to our study we can say that the graph is reflected over x-axis and compressing vertically by 2 units.

Hence, the correct option is B.

Learn more about transformations, click;

https://brainly.com/question/13801312

#SPJ2

15/16 as a decimal rounded to the nearest tenth

Answers

Answer:

0.9

Step-by-step explanation:

[tex]\frac{15}{16}=0.9375\approx0.9[/tex]

for brainiest in 2 minutes

Answers

Answer:

$24 is the selling price NOT INCLUDING TAX (if they want you to add tax)

Another question how fast is Andrew traveling?

Answers

Answer:

Danny

Step-by-step explanation:

Danny's speed is given:

15 mph

Andrew's speed is found from the table.

Since its the direct relationship, we find it using one pair of values:

Speed = miles/times = 21.75/1.5 = 14.5 mph

Danny is faster as 15 mph > 14.5 mph

Speed =Distance/Time

Here speed is equal to slope of box

m=y/xm=29/2m=14.5mph

Danny is faster as his one is 15mph

Find the length and surface area.

Width = 2

Height = 12

Volume = 240​

Answers

Answer:

Length: 10

Surface Area: 20

Step-by-step explanation:

Length:

2*12=24

240/24=10

Surface Area:

2*10=20

Which statement is true about subsets of the real numbers?

Answers

Answer:

The real numbers have the following important subsets: rational numbers, irrational numbers, integers, whole numbers, and natural numbers.Aug 28, 2018

Step-by-step explanation:

(a+b) raise the power of half

Answers

What does a and b equal to?

Please help me :(bbbbbb

Answers

Answer:

im sorry this seems to not be correctly stated

Step-by-step explanation:

PLEASE HELP ASAP WILL GIVE BRAINLEAST TO CORRECT ANSWER

Answers

Answer:

B Increase: 1, 6

B Decrease: 2, 5

Step-by-step explanation:

Brainliest plz ;)

Use the distance formula to slove how far the points are on the a coordinate plane. Points are (7,5)(3,2)

Answers

Answer:

distance is 5 units

Step-by-step explanation:

plug in values

Kevin made $342 for 18 hours of work. At the same rate, how many hours would he have to work to make $247?

Answers

Answer:

13 hours

Step-by-step explanation:

First you have to find the hourly rate at which money is being earned. To do so you divided the money earn ($342) by how many hours it took to earn (18 hours).

Once you do that you're given $19.00 per hour.

Now take the money earned with the unknown time ($247) and divide it by money being made per hour ($19)  and you're given 13 hours

Answer:

13

Step-by-step explanation:

First, you need to find out how much money he is making per hour. To do that, we need to do $342 divided by 18 hours. This gives us 19. We now know that Kevin is making $19 an hour. Next, do $247 divided by $19. This gives us 13. He would need to work 13 hours to make $247.

Simplify the expression.
1/2r – 2r + 6 – 3

Answers

Answer:

-3(r-2)/2

Step-by-step explanation:

r/ 2 − 2 r + 6 − 3

r /2 − 2 r⋅ 2/ 2+ 6 − 3

r/ 2 + − 2r ⋅ 2/ 2 + 6 − 3

r − 2 r ⋅ 2 /2 + 6 ⋅ 2/ 2 + − 3 ⋅ 2/ 2

r − 2 r ⋅2 + 6⋅ 2 − 3 ⋅ 2 /2

r − 4 r + 12 − 6 /2

−3 ( r − 2 ) /2

Hope that helps! Plz, mark brainiest! :D

Have a great day!

what is the value of x? 26 degrees tangent lines

Answers

Answer:

154°

Step-by-step explanation:

The central angle and the angle between the tangents are supplementary, so

x + 26° = 180° ( subtract 26° from both sides )

26 - 26 = 0

180 - 26 = 154

x = 154°

The value of the x will be 154°.

How to find the interior central angle?

The central angle and the angle between the tangents are supplementary.

If there is a circle O with tangent line L intersecting the circle at point A, then the radius OA is perpendicular to line L.

So,

x + 26° = 180°

Subtract 26° from both sides;

x + 26 - 26 =  180 - 26

x = 154°

Hence, the value of the x will be 154°.

Learn more about tangents ;

https://brainly.com/question/10024457

#SPJ2

Other Questions
Help me please! I will mark brainliest for whoever gets it right the fastest. HELP mE need math help 20 points no links or imma report HeLP mE Simplify the following:7(5v8) 1) Drop the er/ir2) Add the ending based on the subjectWrite the correct forms of the given verbs3. leer: to readTCarmenElena y AnaJuanTina y yo4. beber: to drinkToms y RicoElla y yoAna MarlaLas estudiantesLa nia5. abrir: to ooentTTaniaAntonio y LuisaLa profesoraEllos Find the area of the white region in the diagram shown. 2(3x - 2) = 2(x 7) 50pts!! PLEASE HELP IF YOU DO EDGUNITY. Lab: Mouse Genetics (One Trait) lab report.please make one for me so I can easily copy and paste or paraphrase it, my teacher keeps making it do it smh IM TIRED Mason wants to play with Maliyah's Doll House, but first he needs to stop at the clubhouse. If allthree stops are in the shape of a triangle, which of the following distances would NOT be an option? Which of the following is a true statement about ecology?Ecology is the study of relationships of living organisms and their environment.Ecology is the study how animals adapt to their environment.Ecology studies how living organisms have changed over time.Ecology studies the difference between living organisms. How do friends and peers impact on your sexuality The sum of three consecutive integers is -27 what is the product of the smallest and largest of the three integers? Plz help me Im begging plz what is the mRNA in TACCGGATGCCAGATCAAATC? pinocchio says my nose will grow. will it grow or not?dun dun dun what is (-10,10) if i dilate it by 1/2 a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. HELP MEEE BRAINLIEST do this for me? helppp all my point