I like this song, it has a nice ___________ to it.
Steep
Rhythm
Serious
Merchant

Answers

Answer 1
I think the answer is rhythm
Answer 2
I like this song it has a nice Rhythm to it

Related Questions

Is spanking your child okay?

Answers

Answer:

no

only in some cases lol

Explanation:

Answer:

NO IT IS NOT OK!!!

Explanation:

GIVING BRAINLIEST!!!!!!

The Sahara is the world's biggest hot desert. The Sahara stretches across the northern part of Africa.

Which revision uses an appositive to combine these two sentences correctly?

A) The Sahara is the world's biggest hot desert because it stretches across northern Africa.
B) The Sahara stretches across the northern part of Africa and is the biggest hot desert.
C) The Sahara stretches across the northern part of Africa, making it the largest hot desert.
D) The Sahara, the world's biggest hot desert, stretches across the northern part of Africa.

Answers

Answer: D the sahara the worlds biggest hot desert, stretches across the northern part of Africa   :

Answer:

I think the answer is D the sahara the worlds biggest hot desert, stretches across the northern part of Africa

Plz help!!!!!
I still have more

Answers

Answer:

Sections

Hope this Helps!

Answer:

sections

Explanation:

i hoped this helped:)

Help I don’t understand what they are trying to say

Answers

Answer:

sales tsxes

Explanation:

beacue just i know

Answer - H

I think it would be for property tax reason being of ownership

What is the purpose of the sentence?

Strange that the newspapers, so bold and up-to-date as they are, are not full of "How to live on a given income of time," instead of "How to live on a given income of money"!

A.
to express surprise and confusion about how people consider time to be less important than managing money
B.
to make a request to the reader to read more news with the help of newspapers
C.
to ask a question to the reader about how much they understand the importance of time
D.
to show excitement and enthusiasm about the variety of topics that are covered in the newspapers every day
PLS HELP I DON"T HAVE A LOT OF TIMEEEEEEE

Answers

It’s A . Explanation - The newspaper article is saying how people consider time to be less important that money.

Plz help

Read the following excerpt from an argumentative essay. Answer the question that follows.


Critics might say that smart phones in the classroom cause too many distractions. A 2009 article in Education Magazine made just such a claim. Although cell phones can certainly cause distractions, current research suggests that teachers and students are putting phones to better use. A 2013 Educator Insider poll reveals that 67% of high school instructors now encourage students to use phones in the classroom setting. Students without phones are actually at a disadvantage in the classroom. The poll lists Internet access, spell checks, and collaboration as three key uses of smart phones in an educational setting.


How does the author handle the counterclaim?

The author chooses to concede the point and offers no rebuttal.
The author offers an opinion discounting the counterclaim.
The author ignores the counterclaim and avoids responding.
The author supplies a rebuttal that quotes more current research.

Answers

The author supplies a rebuttal that quotes more current research.

Which of the theorists discussed in this course best reflects your beliefs on how children develop and why?

Answers

The correct answer to this open question is the following.

Unfortunately, you did not mention who were the theorists you discussed during the course. You forgot to include their names.

However, trying to help you, we can share the name of the author that best reflects my beliefs on how children develop.

We choose Jean Piaget.

Jean Piaget(1896-1980) was born in Switzerland and during his career, he could understand the behavior of children. He proposed a four-stage in which he put emphasis on the way children grew and mature while receiving external stimuli.

The four stages proposed in the development of children were: sensori-motor stage,  pre-operating stage, concrete operations stage, and formal operational stage.

I consider that his approach is methodical and delivers positive results when parents are trying to understand the way children behave and grow during these different stages.  

What does thanksgiving mean in the catholic view

Answers

Answer: the act of giving thanks; grateful acknowledgment of benefits or favors, especially to God. an expression of thanks, especially to God. a public celebration in acknowledgment of divine favor or kindness. a day set apart for giving thanks to God.

Explanation:

Answer: Catholics deserve the credit not only for the first Thanksgiving, but for the first real religious freedom in America. Not the Puritans whom we call Pilgrims.

Explanation:

If I met my seven year old self today,
What would I tell her,
What would I say
Would I warn her of the future,
please analyze this poem:
Of the bad things yet to come?
Or would I leave her be naive
To keep having fun?
Because my seven year old self, Believed the world a perfect place,
Would she recognise herself?
When she looked into my face?
Even though I’ve learnt so much more,
And ten years have passed since then,
I would give up everything I have,
To view life through her eyes again

Answers

Answer:

The narrator is saying that they used to think the world was some magical place with no flaws, and then they realized it was otherwise.

"Or would I leave her be naïve, to keep having fun?" The narrator is going back and forth between leaving themselves innocent, so that they can enjoy it while it lasts.

The author is considering this because "I would give up everything I have, to view life through her eyes again." As a child, she was innocent, and loved the world, and is wistful to feel the same way again.

Hope this helps :)

Stay Cold,

Brook

what is the plot of the movie australia?

Answers

With the globe on the brink of World War II, Lady Sarah Ashley (Nicole Kidman) travels from Britain to Australia to inspect a cattle ranch she inherited. Reluctantly joining forces with a rugged local known as the Drover (Hugh Jackman), she sets out on a cattle drive across hundreds of miles of harsh terrain to save her ranch. But when they finally reach the town of Darwin, they must contend with the same Japanese bombers that just rained death upon Pearl Harbor.

why doesn't ares kill Percy?? can someone please answer soon.​

Answers

Answer:

Ares doesn't kill Percy because Percy promises to return the lightening bolt, as well as the hel, to Ares when he finds them.

- Jose <3

Ares doesn't kill Percy because Percy promises to return the lightening bolt, as well as the hel, to Ares when he finds them.

What is the theme of the lightning thief?

Identity is a recurring issue in The Lightning Thief, and it is frequently depicted as a battle for the individuals embarking on adventures. Percy has been deemed a troublemaker with limited potential due to his learning problems. He bases his worth and self-esteem on the judgments of several of his professors.

Percy eventually won the combat by stabbing Ares in the heel; Ares tried to assault Percy again in a fit of wrath, but Kronos stopped him. Before leaving, Ares cautioned Percy that he had made a horrible mistake by making the God of War his adversary in Lightning Thief.

Therefore, Ares spares Percy's life because he pledges to return the lightning bolt and the hel to Ares when he finds them.

Learn more about theme here:

https://brainly.com/question/12461958

#SPJ2

Read this passage from chapter 5 of The Prince.

There are, for example, the Spartans and the Romans. The Spartans held Athens and Thebes, establishing there an oligarchy: nevertheless they lost them. The Romans, in order to hold Capua, Carthage, and Numantia, dismantled them, and did not lose them. They wished to hold Greece as the Spartans held it, making it free and permitting its laws, and did not succeed.

How does the text structure help the author convey his central idea in this chapter?

By describing the actions taken by the Spartans and the Romans, Machiavelli sets up a comparison with the actions of other conquering forces discussed in the chapter.
By contrasting the outcomes of Spartan and Roman conquests, Machiavelli provides evidence to support his claim that a prince must destroy a free city in order to hold it.
By contrasting the goals of the Spartans and the Romans, Machiavelli establishes the problem of maintaining control of a conquered city, to which he will propose a solution.
By listing the effects of these Spartan and Roman conquests, Machiavelli supports his overall description of how princes do or do not maintain control over the cities they conquer.

Answers

Answer:

B

Explanation:

Answer:

b

Explanation:

edge 2021

The best way to locate a suffix is to look for a word part that

includes “pre”, “a”, or “en” for example.
shows the word’s central meaning.
is added to the end of the word root.
is added to the beginning of a word root.

Answers

The best way to locate a suffix is to look for a word part that is added to the end of the word root.

A suffix is a word that is added to another word to make a new word.

Suffixes and prefixes are 'added' words that can change a word to another meaning. While prefixes are added before a root word, suffixes are added after the root word. This means that prefixes are added at the beginning of the word while suffixes are added at the end of the root word. For example, in the word "uncomfortable", the root word is "comfort". The prefix is "un-" while the suffix is "-able".

The best way to locate and identify a suffix is by looking at the part of the word that is added to the end of the root word. This can be done by identifying the root word and then looking for the added words. Thus, the correct answer is the third option.

Learn more about suffix here:

brainly.com/question/16501755

Answer:

is added to the end of the word root.

Explanation:

1. This method of text development allows the writers to produce texts with
borrowed ideas from other writers.
A. hypertext
B. intertext
C. context
D. concept

Answers

Answer:

The correct answer is B. Intertext.

Explanation:

Intertextuality refers to both implicit and explicit references to other texts in a text. It has been said that a writer writes all of his texts on the basis of other books he has read, or perhaps based on his entire life experience. On the other hand, from the reader's point of view, it can be said that all texts are always interpreted in relation to some of the texts that precede them and in relation to the reader's life experience and situation. Thus, intertextual references can be observed in all literature and in culture in general.

The method that allows the writers to produce texts with borrowed ideas from other writers is Intertext.

What is intertext?

Intertext refers to the text development refers that development that involves shaping the meaning of a text from another text either by quotation, allusion, calque, plagiarism, or other strategies or by interconnections between similar or related works.

Therefore the correct option is B.

Learn more about intertext here:

https://brainly.com/question/2835157

Restate this quote silence is the residue of fear help please

Answers

Answer:

Silence is the result of fear controlling us.Silence is the fear of speaking up.

Explanation:

"silence is the residue of fear."

Many of us let our fears control us rather than being vocal about our thoughts or morals.

Here's two examples of the quote restated:

Silence is the result of fear controlling us.Silence is the fear of speaking up.

I NEED THE ANSWER ASAP I AM IN A RUSH!!!!


True or False: Kinetic energy of an object is directly proportional to the square of its speed. That means that if its speed doubles, its kinetic energy will quadruple.
Group of answer choices

True

False

Answers

Answer:

False

Explanation:

The answer is False hope this helps

"A Lady " by Amy Lowell
You are beautiful and faded,
Like an old opera tune
Played upon a harpsichord;
Or like the sun-flooded silks
Of an eighteenth-century boudoir. In your eyes
Smoulder the fallen roses of outlived minutes,
And the perfume of your soul
Is vague and suffusing,
With the pungence of sealed spice-jars.
Your half-tones delight me,
And I grow mad with gazing
At your blent colors.

My vigor is a new-minted penny,
Which I cast at your feet.
Gather it up from the dust
That its sparkle may amuse you.( answer for the bottom)

Answers

It would be the first answer

Do you believe that taxpayers should be responsible for funding prison education systems, or do you believe that the money should come from an alternative fund? Why?
I need some help with that question please.​

Answers

Answer:

Yes! I believe this because if you're going to let them out of prision, I think they should be more educated than before so they can make smarter choices in life. If you just let them out before they learn anything, they will more than likely do it again and cause more damadge because they didn't learn anything from sitting in a cell!

Explanation:

Hope this helps! Plz mark as brainliest! :)

is it good to have conflict between friendship and love? with the reason or explanation​

Answers

Answer:

Yes

Explanation:

These types of conflicts can help you learn how to prioritize.  If you have to choose one over the other, your choice reflects upon your values.

From who’s point of view is this?

Answers

Answer:

I believe the answer is A, as the narrator refers to himself as "I"

Hope this helps! <33

USE OF SECOND CONDITIONAL.
If you ____________ (get) more exercise, I’m sure you ________________ (feel) healthier and happier.

Answers

Answer:

if you got more exercise, I'm sure you felt healthier and happier.

Got/ would feel. I saw it somewhere on the website. So hope this helps

Please help me!

What is the theme of 'The Hate U Give'? Please respond with at least 6 sentences! I will figure out the rest! Please and thank you!

Answers

The hate you give shows that we have advanced as a society but have also stayed the same. It also shows a somewhat real account and with what is going on in the world you can see how people form opinions. Some people think ‘if they were bad then they are still bad’. Some people believe the ‘not everyone is like that 10%’ which is true because everyone is good until proven wrong. I believe in the ‘in goodness there is bad and in bad there is good’ but some people are just cruel. Which is very sad hope this helps and good luck!!

What famous American writer doubted Shakespeare authorship? What was the point of his example of catfish fishing?


PLZZZZ HELP

Answers

Answer and Explanation:

Mark Twain was the famous American writer who doubted Shakespeare's authorship. For him, Shakespeare's works contained secret codes that, once unveiled, showed the name of the true author who was Francis Bacon. In this case, he used an example of catfish fishing to represent that Shakespeare was a character, an allegory created and publicized as a persona that was not real, but that was used as a way for Bacon to protect his identity and pretend to be someone else for a public that would not be able to discover the truth.

What type of fallacy or faulty reasoning is used in this passage? x ad populum O begging the claim O genetic fallacy O hasty generalization​

Answers

The fallacy that is used in the situation is the C. genetic fallacy.

What's fallacy?

Fallacy simply means a deceptive argument. It's a argument where the conclusion isn't supported by the premises.

In this case, it's a genetic fallacy which is the study of someone's history or origin than the current meaning.

Learn more about fallacy on:

https://brainly.com/question/20939336

How does Chopin create feelings of freedom and liberation in The Story of an Hour?​

Answers

Answer:

Even in her momentary grief, she describes the “open square before her house” and “the new spring life.” The outdoors symbolize freedom in the story, so it's no surprise that she realizes her newfound freedom as she looks out her window.

Mark the preposition in the sentence.

6. The cat jumped off the train

Answers

hmm i think the preposition in the sentence would be “off”.
explanation: preposition means a word that shows the relationship between the noun or pronoun after it (its object) and some other word in the sentence.

Gilbert offered to help right away. Each day I met him after school and he told me what they'd done in school.

“What did you cover today in geography?”

“Weather patterns.”

“Can I get your notes tomorrow?”

“For sure.”

“Thanks. I’ll have the others back soon. I’m almost finished.”

—The Boy Who Harnessed the Wind, William Kamkwamba

What do the details in this passage tell you about Kamkwamba?

He is determined and hard working.
He doesn’t want anyone’s help.
He is having a hard time keeping up.
He is ready to give up.

Answers

Answer:

the answer is " He is determined and hard working".

Answer:

he is determend and hard working

Explanation:

crooct on edge

Hurry up! The bus (come).​

Answers

Answer:

came, or is coming

Explanation:

past-tense, future-tense

Which sentence correctly uses
this definition of the following
word:
locate - to set, fix, or
establish; to settle
A. The evacuees needed a place to locate
themselves until after the terrible storm.
B. She determined to locate her missing
homework so she wouldn't have to start
Over on it.
C. Ned tried to locate the fishing hole he
had discovered last summer.

Answers

Answer:

a

Explanation:

a is the correct answer because it best describes the meaning to settle, b describes it as finding something and c is also as finding something.

Please Help ASAP!! Will mark Brainliest!

Answers

Answer:

1. Making allusion to Romeo.

Explanation: This means that the person is a lover like Romeo just like in the Romeo and Juliet playlet.

2. Making allusion to Mona Lisa

Explanation: This means that the wife's smile seem to be compared to that of Mona Lisa, a portrait made by Leonardo Da Vinci.

3.  Making an allusion to Albert Einstein

Explanation: This means that the little boy is just as intelligent as Einstein.

4. Making allusion to a Grinch

Explanation: This means that the person should not be a disturbance and annoying like a Grinch.

5. Making allusion to the good Samaritan

Explanation: This means that Ben acted generous and helpful just like the biblical good Samaritan story.

6. Making allusion to herculean task

Explanation: This means that the triathlon is a difficult task but Toby can meet up to the task.

7. Making allusion to kryptonite

Explanation: This means that Kylie is like a drainer or harmful to Lance just like a kryptonite.

8.  Making allusion to the biblical Judas.

Explanation: This means that the person shouldn't be disloyal and a betrayal just like the biblical Judas Iscariot.

MAKING SENTENCES

Achilles' Heel:

Don't be caught up by Achilles' Heel. Get up and move on!

Pinocchio:

This boy is a Pinocchio. He has deceived friends again.

Garden of Eden:

His home looks like Garden of Eden; therefore, we stayed a little longer.

Peter Pan:

You should act maturely when you get there. Don't be a Peter Pan.

Explanation:

I have been to show what is been alluded to and explained each one. Also, I have made sentences with the given word(s).

Allusion is known to be a figure of speech that is used to make direct or indirect reference to persons, events or situations. The reader is then left to make connection to what is alluded to having a knowledge of it.  

N.B: The system cannot allow me to post the other sentence I made. It is rejecting. Check out the last sentence in the comment section. Thank you.

Other Questions
four main towns along the genesis route Michael bought three baseballs from a sports store. Each baseball cost the same amount. The total cost was $8.37. If C represents the cost of each baseball, which of the following statements are true? Select all that applyThe value of c can be found using the formula 30+837The value of c can be found using the formula C/8.37 = 3Each baseball cost $25.11Each boseball cost $279 Need help ASAP giving away 15 points will mark brainlyist as well pleaase help withhh tthis Please Answer! I will give brainiest. The Picture is down below :)Thank You! EXERCISE 1 IMAGINE YOU ARE A CHILD AT SCHOOL .WRITE A DIARY ENTRY IN ABOUT 150-200 WORDS ABOUT YOUR EMOTIONS THE DAY BEFORE YOUR SCHOOL TAKES YOU TO A THEME PARK Please answer these questions and I swear I will give you brainlist I promise I will answer this question part a and part b please What is the length of the missing leg?45 and 36 Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air Texas Roadhouse opened a new restaurant in October. During its first three months of operation, the restaurant sold gift cards in various amounts totaling $1,800. The cards are redeemable for meals within one year of the purchase date. Gift cards totaling $728 were presented for redemption during the first three months of operation prior to year-end on December 31. The sales tax rate on restaurant sales is 4%, assessed at the time meals (not gift cards) are purchased. Texas Roadhouse will remit sales taxes in January.Required:a. Record (in summary form) the S3,500 in gift cards sold (keeping in mind that, in actuality, the firm would record each sale of a gift card individually). b. Record the S728 in gift cards redeemed. c. Determine the balance in the Deferred Revenue account (remaining liability for gift cards). HEY CAN SOMEONE HELP ME WITH MY LASTEST MATH QUESTION I WILL GIVE BRAINLIST PLEASE :))) The owner of Chips etc. produces two kinds of chips: lime (L) and vinegar (V). He has a limited amount of the three ingredients used to produce these chips available for his next production run: 4800 ounces of salt, 9600 ounces of flour, and 2000 ounces of herbs. A bag of lime chips requires 2 ounces of salt, 6 ounces of flour, and 1 ounce of herbs to produce; while a bag of vinegar chips requires 3 ounces of salt, 8 ounces of flour, and 2 ounces of herbs. Profits for a bag of lime chips are $0.40, and for a bag of vinegar chips $0.50. evaluate 3 + jk + k ^3 when j = 2 and k = 6