How many roots does this function have in common f(x)=x^2-4x-5

Answers

Answer 1
Hi, the roots are -1 and 5. I don’t really understand your question but i hope this helps :$

Related Questions

Which of the following best describes the graph of the polynomial function
below?

Answers

Answer:

Step-by-step explanation:

The given curve crosses the x-axis in two places, (-2, 0) and (0, 0), which are the zeros.  This parabolic curve opens up and has its vertex (minimum) at (-1, -1).

Answer: The graph has two zeros.

Step-by-step explanation:

The given graph is the graph of parabola open upward. In the graph of parabola, we will have two solutions since the highest degree of the function is 2.

y = ax^2 + bx + c, where a, b, c are real number and a ≠ 0.

You can see the height degree of the function is 2.

Therefore, there should be two zeros of the function.

According to the given graph of parabola has two zeros at x = -2 and x = 0.

The graph cross the x-axis at x = -2 and x = 0.

Hence, the graph has two zeros.

Answer is A. The graph has two zeros

Please help me with this

Answers

Answer:

6y

Step-by-step explanation:

The two figure are squares with the same area

side = √area = √y^2 = y (with y>0 because a length can‘t be negative)

perimeter = side * 6 = y * 6 = 6y

Suppose a city with a population of 700,000 has been growing at a rate of 7​% per year. If this rate​ continues, find the population of this city in 25 years. The population in 25 years will be approximately...?

Answers

Answer:

approximately 1,925,000

Step-by-step explanation:

700,000 * 0.07 = 49,000    this would be the growing rate per year.

49,000 * 1,225,000    this would be the population grown in 25 years.

700,000 + 1,225,000 = 1,925000    this would be the total population that was in the city and the population that has grown in the 25 years.

Hope this helps

Which set of ordered pairs could be generated by an exponential function?
(1,1), (2,1/2), (3,1/3), (4,1/4)
(1,1), (2,1/4), (3,1/9), (4,1/16)
(1,1/2), (2,1/4), (3,1/8), (4,1/16)
(1,1/2), (2,1/4), (3,1/6), (4,1/8)​

Answers

Answer:

C

Step-by-step explanation:

y=x(1/2)^x

A school sold a total of 250 tickets to a show. Adult tickets cost $7.25 and student tickets cost $5.50. At the end of the evening the amount of money
collected was $1,602.50. Write and solve a system of equations to determine the number of student tickets sold
В І ца
7.25x+5 5y=1,602.50
1 / 10000 Word Limit

Answers

Answer:

The system of equations is:

x + y = 250                         (1)

7.25x + 5.50y = 1602.50   (2)

with x = Adult tickets

       y= student tickets

Solution

Let's equation (1)

x+y=250

x=250-y (a)

subtitute x in aquation (2)

7.25(250 - y) + 5.50y=1602.50

1812.50 - 7.25y + 5.50y= 1602.50

1812.50 -1.75y = 1602.50

-1.75y = 1602.50 - 1812.50

-1.75y = -210 ↔multiply both sides by (-1) to remove the minus sign

y= 210/1.75

y= 120

Substitute y in equation (1)

x + 120 = 250

x= 250 - 120

x =130

Let's check our results in equation (1)

x + y =250

120 + 130= 250 ↔ 250 = 250

At the end of the evening they 120 students tickets and 130 adults tickets

Step-by-step explanation:

You can check the results in any of the equations

please help. its for an assignment that is due today.

Answers

Area of isosceles triangle is 7.8235

Height = base/2 x tan 41 = 2.61

Base length = 2 x ( side length of triangle) x cos 41

6= 2 x ( side length of triangle, assume it b ) x 0.754

6= 1.509 x b

b = 6/ 1.509

b= 3.975

Area = 1/2 b x h

= 1/2 x b^2 Sin square theta

= 7.8235


Please help I put 74 points there is an image

Answers

Answer:

x = 37 y = 27

Step-by-step explanation:

x = y + 10

x + y = 64

y + 10 + y = 64

y = 27

64 - 27 = 37

Answer:

What coatside dad said

Step-by-step explanation:

Please help, will give Brainliest and 40 points!

Answers

Answer:

3^12

Step-by-step explanation:

(3^2)^6

6 * 2 = 12

3^12

Calculator check: (3^2)^6 = 531441

3^12 = 531441

Answer:

3^12

Step-by-step explanation:

We know that a^ b^c = a^(b*c)

3^2^6 = 3^(2*6) = 3^12

A pizza parlor advertises pizza options. They offer 7 toppings and allow up to 4 on each pizza. Write an expression that represents this situation.
A: 7!
B: 7!/3!
C: 7!/4!3!
D: 4!3!/7!

Answers

Answer:  Choice C

Explanation:

This is after using the nCr combination formula

[tex]_n C _r = \frac{n!}{r!*(n-r)!}[/tex]

where in this case n = 7 and r = 4. Note how n-r = 7-4 = 3.

We use nCr instead of nPr because the order of the toppings doesn't matter.

PLEASE HELP ME!! this is due tonight and i really need help with this so i can do other assignments

explaining your answer = brainliest/ five stars

the area of this square = ___ cm

Answers

Answer:

64cm² I think :) if u get it wrong dont blame it on me.

Answer:

64 cm^2

Step-by-step explanation:

The area of a square can be calculated by A = s^2 (Area = side squared aka the side multiplied by itself)

A = s^2

= 8^2 (8 x 8)

= 64 cm^2

The science department orders a new telescope and pays $253.87 after tax. The tax rate is 6% . What was the original price of the telescope

Answers

The price after tax is £253.87 so to find the original price you have to deduct 6% but first you need to find 6%.

Easiest way to find 6% is by finding 10% or 2% or 1% / whatever you find easiest. For me it would be 1%

If you find 1 % you would then multiple it by 6 to give you 6%

10% is £25.38 (move the decimals 1 unit)
1% is £2.54 (move decimals 2 units)
Always round up

£2.54 X 6 = £15.24

£253.87 - £15.24 = £238.63

Answer: dont listen to the answer above

Step-by-step and you'll fall down the shdausta and tyou get deleminate dby the stairs and bu the fat cat in cthe chaet

Solve for in the diagram below.
(2x + 45°
7
RO
7 -

Answers

Answer:

45°

Step-by-step explanation:

The angles should add to 180°. so we can say 2x+45+x=180

3x+45=180

3x=135

X=45°

Answer:

x = 45°

Step-by-step explanation:

The sum of both angles should add up to 180°, because they are supplementary. Supplementary angles is just another way of saying two angles on a straight line. In order to find the value of x:

Given |

[tex]2x + 45 + x = 180[/tex]

2x + x

Combine like-terms. |

[tex]3x + 45 = 180[/tex]

180 - 45

Subtraction Property of Equality. |

[tex]3x = 135[/tex]

135 / 3

Division Property of Equality. |

[tex]x = 45[/tex]

Solve this system of equations using the ELIMINATION method.

3x - 2y = 1

2x + 2y = 4

Answers

hope this helps please like and mark as brainliest

Answer:

x = 1

y = 1

Step-by-step explanation:

3x - 2y = 1

2x + 2y = 4

3x - 2y + 2x + 2y = 1 + 4

3x + 2x = 5

5x = 5

5x ÷ 5 = 5 ÷ 5

x = 1

2x + 2y = 4

2(1) + 2y = 4

2 + 2y = 4

2 - 2 + 2y = 4 - 2

2y = 2

2y ÷ 2 = 2 ÷ 2

y = 1

Check:

3x - 2y = 1

3(1) - 2(1) = 1

3 - 2 = 1

x and y being 1 works for the first equation.

2x + 2y = 4

2(1) + 2(1) = 4

2 + 2 = 4

x and y being one works for both equations.

Need help ASAP DUE IN A COUPLE MINUTES PLEASE AND SHOW WORK ?!!!

Answers

Answer:

here u go

Step-by-step explanation:

what i did was 15*7 which is 105

and then i did 105/2 which is 52.5 ft

Answer:

V = 1237 cubic feet

Step-by-step explanation:

V of cylinder = πr^2h

r = 7.5 ft (15/2)

h = 7 ft

v = ((7.5)^2)π*7 = 1237.002107 cubic feet

Which is an equation of a direct proportion? CLEAR CHECK y=8x y=12x+4 y=12x y=4x−4

Answers

Answer:

[tex]y=8x, \\y=12x[/tex]

Step-by-step explanation:

Proportional functions can be written as [tex]y=kx[/tex], where [tex]k[/tex] is some constant of proportional. Since directly proportional functions always pass through the origin, the y-intercept must be 0 (no additional number before or after [tex]x[/tex] term). The only answers that fit this format are:

[tex]\rightarrow \boxed{y=8x}\\\rightarrow \boxed{y=12x}[/tex]

Answer: Y=8x

Step-by-step explanation:

What is the translation shown in the graph?

Answers

Answer:

The shape is translated four units left, and 2 units up, therefore the answer would be x=-4 and y=+2

Answer:

P= (1,-1)= P'= (-3,1)

T=(4,-1)=T'= (0,1)

R=(5,1)=R'= (1,3)

A= (5,3)=A'= (1,5)

So you would move the points 4 units across (left) and 2 units up (2,-4)

I would think your answer is right, it would be the second choice. Its just a little hard to determine because you would use the method of moving the point but to double check you would use one of the points, for example (1,-1) you would do 1+2-4 to see if you would get -3 and do the same with -1, -1+2-4. I hoped this helped!

Evaluate the function.
f(x) = -x^2 + 6
Find f(-3)

Answers

Answer:

-3

Step-by-step explanation:

You plug the value of -3 into where the x is {-(-3)^2} + 6, resulting in -3.

LAWD please help. I have summer school

Answers

Me too. It's the third option. :)

Answer:

I think its the third bubble. Hopefullly this helps. im pretty sure its correct.

Step-by-step explanation:

1st. add rt to both sides so that it cancels out. That should give you xy= s+rt.

2nd. Then divide x from both sides to single out the y. since x is multiplying with y you must use the inverse operation and divide by X. This should leave you with y= (s+rt)÷x

Help!! Please also explain how you got your answer

Answers

Answer:

y = -½x + 4

Step-by-step explanation:

the line passes point of y-intercept (0, 4) ,

and another point (6, 1)

the slope = (1-4)/(6-0) = (-3)/6 = -½

so the Equation is y = -½x + 4

Factorise completely the expression below: 6ax+12by-9ay-8bx​

Answers

Answer:

Step-by-step explanation:

6ax +12by -9ay -8bx

=6ax -8bx -9ay +12by

=2x(3a -4b)-3y(3a -4b)

=(2x-3y)(3a-4b)

What is the area of a triangle with a base of 7cm and a height of 120% of the base?
Calculate the area

Answers

Answer:

29.4 cm^2

Step-by-step explanation:

We can use a proportion to find the height:

120 : 100 = x : 7

x = (120 *7)/100 = 8.4 cm

Area = (base * height)/2 = (7 * 8.4)/2 = 29.4 cm^2

Answer:

29.4cm²

Step-by-step explanation:

First we are going to find 120% of 7.

7 × [tex]\frac{120}{100}[/tex] = 8.4 cm

Therefore, 8.4 cm is the height.

Area =  [tex]\frac{1}{2}[/tex] Base × Height

= [tex]\frac{1}{2}[/tex] × 7 × 8.4 = 29.4cm²

The expression 6.7\cdot1.45^t6.7⋅1.45 t 6, point, 7, dot, 1, point, 45, start superscript, t, end superscript models the number of billions of genetic sequence bases available in the public database of the Whole Genome Shotgun project ttt years since 200220022002. What does 1.451.451, point, 45 represent in this expression?

Answers

Answer: 1.45 is a growth factor.

Step-by-step explanation:

Exponential growth function: [tex]y=Ab^x[/tex], where A = initial value , b = growth factor (if b>1)

Here, The expression [tex]6.7\cdot(1.45)^t[/tex] models the number of billions of genetic sequence bases available in the public database of the Whole Genome Shotgun project t years since 2002.

Here, b=1.45 >1

Thus,1.45 is a growth factor.

Write this percentage as a fraction in its simplest form.
30%​

Answers

Answer:

30/100

Step-by-step explanation:

30% as a fraction is 3/10; In simplest form is 30% = 30/100.

The answer is 3/10 :)

will mark brainliest!!!!]


Find the distance between the points (-5, -10) and (2, 4).

Answers

Answer:

15.65 units

Step-by-step explanation:

Given data

x1=-5

y1=-10

x2=2

y2=4

The expression for the distance between two points is

d=√((x_2-x_1)²+(y_2-y_1)²)

substitute

d=√((2-(-5))²+(4-(-10))²)

d=√(2+5)²+(4+10)²

d=√7²+14²

d=√49+196

d=√245

d=15.65 units

Hence the distance between the points is 15.65 units

4x +y = 10 graph the linear equation​

Answers

Graph not attached, linear equation: y=-4x+10

Please help if yk tha answer :))

Answers

Answer:

cos θ = -0.948

Step-by-step explanation:

First find θ of sin θ by taking the inverse:

θ = arcsin(0.312).

Then consider the interval of π/2 < θ < π, and set sin θ equal to arcsin(0.312).

arcsin(0.312) = 0.317297388112..

[ Hold on I am finishing up work ]

In how many year the interest will became equal to the principal is rs.1200 is deposited at the rate of 25% in a bank ​

Answers

Given:

Principal = Rs. 1200

Rate of interest = 25%

To find:

The time in which the interest will became equal to the principal.

Solution:

We have,

[tex]P=1200[/tex]

[tex]r=\dfrac{25}{100}[/tex]

[tex]r=0.25[/tex]

If interest is equal to the principal, then

[tex]Amount=Principal+Interest[/tex]

[tex]Amount=1200+1200[/tex]

[tex]Amount=2400[/tex]

The formula for amount is:

[tex]A=P\left(1+r)^n[/tex]

Substituting [tex]A=2400, P=1200, r=0.25[/tex] in the above formula, we get

[tex]2400=1200(1+0.25)^n[/tex]

[tex]\dfrac{2400}{1200}=(1.25)^n[/tex]

[tex]2=(1.25)^n[/tex]

Taking log on both sides, we get

[tex]\log2=\log(1.25)^n[/tex]

[tex]\log2=n\log(1.25)[/tex]               [tex][\because \log a^b=b\log a][/tex]

[tex]\dfrac{\log2}{\log(1.25)}=n[/tex]

[tex]n\approx 3.11[/tex]

Therefore, the interest will became equal to the principal in about 3.11 years.

What is the value of y in the equation y = 3x - 2, when x = 2

Answers

Answer:

y=4

Step-by-step explanation:

3 x 2=6

6 - 2= 4

Answer:

y = 4

Step-by-step explanation:

Equation: y = 3x - 2

Plug in x = 2

New equation: y = 3(2) - 2

Simplify: y = 6 - 2 --> y = 4

Answer: y = 4

the question= find the percent of each number
1.) 78% of 160
2.) 12% of 325
also could u put an explanation

Answers

Answer:

78 x 160 /100

= 124.8

12 x 325/100

= 39

Step-by-step explanation:

PLEASE please help me with this!! its due tonight. THANK YOU.

explaining your answer = brainliest

the area of the parallelogram is 49 square centimeters.
y = ___ cm

Answers

Answer:

[tex]y = 12.25[/tex]

Step-by-step explanation:

Area of parallelogram = [tex]49 {cm}^{2} [/tex]

∴ Side of Parallelogram = [tex]s = \frac{perimeter}{4} [/tex]

[tex]∴ \: s = y[/tex]

[tex]y = \frac{49}{4} [/tex]

[tex]y = 12.25[/tex]

Hope it is helpful...
Other Questions
Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Please help!!!hi,can you please help me with this?thanks can someone answer this please one of the main ways that federal and state courts differ is the process of discovery that is required in each court. true or false? What is the reporters motive in article 1?What is the reporters motive in article 2?Which term from Senator Nelsons quote in article 2 is an example of bias? Help Me please!!!!! Rn calculate the mass in 4.05*10^22 molecules of calcium phosphate Which event is inferred by most scientists to be responsible for a climate change that has recently led to a decrease in the size of most glaciers? * a decrease in the rate of divergence of lithospheric plates along a mid-ocean ridge O a decrease in the amount of insolation reaching Earth's surface an increase in the amount of greenhouse gases in Earth's atmosphere an increase in the amount of vegetative cover in the tropics How is an ammeter connected in a circuit to measure current flowing through it? can someone please explain how to complete this thanks A skier of weight 700 N is pointed down a ski hill that has a slope angle of 25 above horizontal.What is the component of his weight pulling him down the slope.O 634NO 326NO 296NO 700N The following is a comprehensive problem which encompasses all of the elements learned in previous chapters. You can refer to the objectives for each chapter covered as a review of the concepts.Note: You must complete part 1 before completing part 2.Based on the following data, prepare a bank reconciliation for December of the current year:a. Balance according to the bank statement at December 31, $283,000.b. Balance according to the ledger at December 31, $245,410.c. Checks outstanding at December 31, $68,540.d. Deposit in transit, not recorded by bank, $29,500.e. Bank debit memo for service charges, $750.f. A check for $12,700 in payment of an invoice was incorrectly recorded in the accounts as $12,000.Enter all amounts as positive numbers.Kornett CompanyBank ReconciliationDecember 31, 2014SubtotalAdjusted BalanceDeductAdjusted Balance Simplify (2x^2 + 4x) - (7x - 3x^2 + 5) A shipping carton is in the shape of a triangular prism. The base area of the triangle is 6 inches squared and the the height of the prism is 15 inches. how many cubic inches of space are in the carton? Describe any six risky situations youth are frequently exposed to Very tired1) The professor (teach)five classes Monday. He (be)afterward2) You (feed)the birds that we saw yesterday. Some of them (be)cardinals.first on the trail Saturday, because he (know)the way3) Andy (go)better than we did.4) The house (be)dirty after they left. We (clean)it yesterdaythe motorcycles in the garage, then they (eat)5) The boys (put)lunch6) My friends and I (find)some gold in the river. Then we (look)formore.7) 1 (like)to write poetry when I (be)eight years old.8) Charlotte and I (see) lightening in the sky Thursday night; the storm (come)fast.9) The children (go)to the park yesterday. They (stay)for two hoursoutside after it (snow)Three inches of snow (fall)10) We (play)that dayI need to past simple tense?? write a rough draft narrative essay about overcoming a challenge does anyone know the quotient of x and y Dichotomous key (PLZ HELPLPP)