how does the input distance of a third-class lever compare to the output distance​

Answers

Answer 1

Answer:

A first-class lever: fulcrum is between input and output force; second-class lever: output force is between input force and fulcrum; third-class lever: input force is between fulcrum and output force


Related Questions

Stress is __________.
A.
positive or negative, depending on circumstances
B.
a body's automatic physical response
C.
a negative reaction to outside influences
D.
A and B only

Answers

Answer:

(A)

Explanation:

Depending on the circumstances, there are such things called good stress and bad stress.

What is sin(77°)? plz help​

Answers

Answer:

Value of Sin(77 degree) = 0.97437006

Degree / Radian Function

(angle in degree) (angle in radian) Sin Cos Tan Cot Sec Cosec SinH CosH TanH CosecH SecH CotH Arc Sin Arc Cos Arc Tan Arc Cosec Arc Sec Arc Cot

Name two things that Arjun and Diya did to get accurate measurements of the angles in their experiment

Answers

Answer:

i dont know them

Explanation:

What is the question. What angle?

What is one benefit of a cardio kickboxing workout?
A. It is a total body exercise.
B. It focuses specifically on aerobics.
C. It focuses specifically on anaerobics.
D. It focuses on the core muscles.

Answers

Answer:

D. It focuses on the core muscles

Answer:

A. It is a total body exercise

Explanation:

In cardio kickboxing as described by my school is "

a total body exercise that combines aerobic and anaerobic workoutsan improvement in body fat compositionan efficient use of workout timea boost in confidence and self-esteemrelief of stress and increased energy levelsvaluable self-defense skills

The first benefit is the one which we are focusing on because all the other answers are correct but A. Total body exercise is the best answer because it covers all of them as an compendious answer

Also I took the test and got this correct

pls help Which one of the following is NOT acceleration
A.
a change in mass
B.
a change in direction
C.
an increase in velocity
D.
a decrease in velocity

Answers

Answer:

C

Explanation:

Am increase in velocity?

Answer:

change in mass is not acceleration

Planetesmals are made from

Answers

A planetesimal is an object formed from dust, rock, and other materials. According to the planetesimal hypothesis, when a planetary system is forming, there is a protoplanetary disk with materials from the nebulae from which the system came. This material is gradually pulled together by gravity to form small chunks.

Brainliest or a thank you please :)) <3

Which of the following is not a unit of volume?
A. L

B. mL

C. m^3
​​

D. cm^2
​​

Answers

Cm2 it is unit of area not volume

Explanation:

D. cm^2

It's a unit for quadruple centimeters. All of the others are used to charge the amount of water in a specific bowl etc.

The tallest Ferris wheel in the world is located in Singapore. Standing 42 stories high and holding as many as 780 passengers, the Ferris wheel has a diameter of 150m and takes approximately 30 minutes to make a full circle. Determine the speed of the riders (in m/s) on the Singapore Flyer.

Answers

Answer:

The speed of the riders on the Singapore Flyer is approximately 0.262 m/s

Explanation:

The dimensions of the tallest Ferris wheel in the world are;

The diameter of the Ferris wheel, D = 150 m

The tine it takes the Ferris wheel to make a full circle, T = 30 minutes = 30 min × 60 s/min = 1,800 seconds

The angular velocity of the Ferris wheel, ω = 2·π/T

The linear velocity of the Ferris wheel, v = r·ω = The speed of the riders

Where;

r = The radius of the Ferris wheel = D/2

D = 150 m

∴ r = 150 m/2 = 75 m

∴ v = r·2·π/T

∴ v = 75 m × 2 × π/(1,800 s) ≈ 0.262 m/s

The speed of the riders on the Singapore Flyer, v ≈ 0.262 m/s

If the two forces on an object are equal in size and opposite in direction, the forces are balanced, and no change
in motion results. Which of the following situations is an example of balanced force acting upon an object?
O A rope being pulled from both sides with equal force
O An 11-gram pen falling off a table onto the floor
O A car moving constantly at 30 miles per hour
O A rock accelerating as it rolls down a hill

Answers

Answer:

a rope being pulled from both sides with equal force

Explanation:

:)

PLEASE HELP!!! *FOR TEST TMR*
What is the Scientific definition of Consumerism?

Answers

Explanation:

Consumerism is a social and economic order that encourages the purchase of goods and services in ever-greater amounts. ... In economics, consumerism refers to economic policies placing emphasis on consumption.

Help it is timed help

Answers

Answer:

It is an object that remains a magnet forever.

Explanation:


Someone please help me

Answers

Answer:

A thesis should be a statement that can be argued.

Explanation:

What units are used to measure mass and weight?
O Mass and weight are measured in kilograms. O Mass and weight are measured in newtons. Mass is measured in kilograms, and weight is measured in newtons.
O Mass is measured in newtons, and weight is measured in kilograms. ​

Answers

Answer:

mass is measured in kilograms and weight is measured in newtons

Explanation:

Can some one please help me

Answers

Answer:

its "up, then down, then up"

Explanation:

Ayala is making salad dressing. She mixes oil and vinegar in a blender until a smooth consistency is formed. Explain whether this is a heterogeneous or a homogeneous mixture and why

Answers

Answer:Hetero

Explanation: Honestly, same as the last guy said

What kind of energy does an electromagnet use to pick up metallic objects?

Answers

Answer:

Magnetic energy is used by an electromagnet  to pick up metallic objects

Explanation:

An electromagnet generates its own magnetic field in presence of electric current.

As an electric current is induced in an electromagnet , it  magnetic dipole arrange themselves in order to behave as a magnet and hence generate magnetic field with a proper north and south. This leads to attraction of metallic object.

Hence, it can be said that Magnetic energy is used by an electromagnet  to pick up metallic objects

Which of the following is not true about a scientific name?

a. they should be typed in italics
b. they are derived from Greek and Latin words
c. they contain a genus and species name
d. they can vary from location to location

Answers

Then answer would be D

According to ohms law, as the voltage increases across a 40 ohm resistor what happens to the current, resistors, and resistance

Answers

Answer:

As the voltage increases, the current flowing through the circuit increases while the resistance of the resistor remains constant.

Explanation:

Ohm's law states that the current flowing through a circuit is directly proportional to the applied voltage.

V = IR

where;

I is the current

R is the resistance

V is the applied voltage

Based on this law (Ohm's law), as the voltage increases, the current flowing through the circuit increases while the resistance of the resistor remains constant.

tic energy
15.The energy changes that take place when a stone falls freely from rest to
the ground can be orderly arranged as
A. Kinetic energy → Potential energy
B. Sound energy → Potential energy
C. Potential energy
→ Sound energy
D. Potential energy
16.A ductile material is that which
→ Sound energy
→ Heat.
→ Kinetic energy → Heat.
→ Kinetic energy → Heat.
→ Kinetic energy → Heat energy
→ Sound.​

Answers

Answer:

15. potential- kinetic -potential

16. I don't understand

Ductile materials are materials that can be drawn into wire e.g copper

Answer:

15.A

Explanation:

a falling objects posses kinetic energy whiles objects at rest has potential energy

Ammonia is a common____?

Answers

Answer:

Base

Hope this helps! :)

Ammonia (NH3) is a common toxicant derived from wastes (see Figure 1), fertilizers and natural processes. Ammonia nitrogen includes both the ionized form (ammonium, NH4+) and the unionized form (ammonia, NH3). ... Temperature also affects the toxicity of ammonia to aquatic life.

PLZ HELPPPPP (NO BS)​

Answers

Answer:

its kainda blurry aploude another pic

Answer:

2

Explanation:

A bird flies South for the winter at a constant force of 51 N. Suddenly a wind with a force of 35 N blows due South. What is the net force of the bird?

Answers

Answer:

86N

Explanation:

The bird is going south and the wind is also blowing south so all the force is acting in the same direction thus it all adds up.

Eren Jagear supremacy? kind of.. rip? Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?Eren Jagear supremacy? kind of.. rip?​

Answers

sis i love the eren season 1-2-3-4 but the eren season 5?....... i just :')

Answer:

Explanation:

Aaron yogurt supremacy

Can someone Please help me ?

Answers

up then down, think of it as like a rope

A lens 57.8 cm from an object
forms an image 38.5 cm from the
lens. What is the focal length of
the lens?

Answers

Answer:

23.11

Explanation:

accellus

The focal length of the lens is approximately 115.3 cm. The explaination is  explained below.

To find the focal length of the lens, we can use the lens formula:

1/f = 1/v - 1/u

Where:

f is the focal length of the lens

v is the distance of the image from the lens

u is the distance of the object from the lens

Given:

v = 38.5 cm

u = 57.8 cm

Let's substitute these values into the formula:

1/f = 1/38.5 - 1/57.8

Now, let's calculate the right side of the equation:

1/f = (57.8 - 38.5) / (38.5 * 57.8)

= 19.3 / (2223.3)

≈ 0.008677

Now, we can find the focal length (f) by taking the reciprocal of both sides:

f = 1 / (0.008677)

≈ 115.3 cm

Therefore, the focal length of the lens is approximately 115.3 cm.

Learn more about lens on:

https://brainly.com/question/29834071

#SPJ2

As distance ________________ between two objects, gravitational force will _________________. *
1 point
a. increases, increase
b. increases, decrease
c. decreases. increase

Answers

Answer:

b. increases, decrease

Explanation:

Calculate the weight of a 2.3 kg squirrel

Answers

Answer:

Lemme think rq

*inserts writing noises*

*insert intese thinking*

*insert big brain moment*

Well the weight IS 2.3 kg so I think the weight of a squirrel is 2.3 kg

One of the most dangerous side effects of an erupting volcano is a

Answers

Answer:

One of the most deadly effects of a volcano is the ash coming from the eruption, which carries poisonous gases that are harmful to humans, plants, and animals alike.

Explanation:

:))))))))

What could be the average human density? Justify?

Answers

Answer:

985 kg/m3

Explanation:

The average density of the human body is 985 kg/m3 k g / m 3 , and the typical density of seawater is about 1020 kg/m3 k g / m 3 .

Explanation:

the worldwide human population density is around 7,500,000,000 ÷ 510,000,000 = 14.7 per km2 (38 per sq. mi.). If only the Earth's land area of 150,000,000 km2 (58,000,000 sq. mi.) is taken into account, then human population density is 50 per km2 (129 per sq.

Dos resistencias de 30 y 20 Ω se conectan en seria a un generador que tiene una diferencia de potencial de 20 V entre sus bornes. a. Determina la resistencia equivalente de la asociación b. Dibuja el circuito y coloca un amperímetro que indique el valor de la intensidad de la corriente y unos voltímetros que muestren la diferencia de potencial entre los extremos de las resistencias ¿Qué valores muestran estos aparatos?

Answers

Answer:

   V = 12V,  V = 8V

Explanation:

a) In this series circuit the equivalent resistance is

          Req - R1 + R2

          Req = 30 + 20

          Eeq = 50 Ω

b) see attached

c) the circuit current is

          i = V / Req

          i = 20/50

          i = 0.4 A

voltages are>

         V = 0.4 30

          V = 12V

           V = 0.4 20

            V = 8V

Other Questions
A line graph titled Video Rental Stores has year on the x-axis and stores (thousands) on the y-axis. In 2009, there were 4,000 stores.The line graph shows the number of video rental stores for the years 2005 through 2012.There were stores in 2009. Which statement below is NOT a statement within the Cell Theory?A. all cells come from other cellsB. all organisms are composed of cellsC. the cell is the basic unit or organization of organismsD. all cells contain DNA (genetic information) What is wrong with the claim statement: "Everyone should use a cell phone." In the circular flow model, businesses provide goods and services to whichpart of the economy?A. BusinessesB. Product marketsC. Resource marketsO D. Households The Mauryan Empire was called India's Silver Age.True or False which experimental probability from coach nelson's experiment equals the theorectical probability? what is this probability? The radius of a circle is 7 miles. What is the circle's area?Use 3.14 for . A water pipe has a flow of 2 gallons per minute how many 2 qt could fill it in 1/2 hour? April ought some sports drinks and slices of pizza for her friends. She bought 3 more sports drinks than slices of pizza. If her total was $21.25, how many sports drinks did she purchase? (1 sports drink is $1.75, one pizza slice is $2.75){System of Operations} La oracin que representa un smil es: A. . Cerca del Tajo, en soledad amena, B. . Si no regresas pronto a mi lado, morir desangrado C. Los invisibles tomos del aire D. Eres como el viento tibio de los arenale What river connects the Great Lakes to the Atlantic Ocean? PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters?