How does Jefferson address the possibility that a future General Assembly could overturn this law?

Answers

Answer 1

Answer:

How does Thomas Jefferson address the possibility that a future General Assembly could overturn this law? "Act For Establishing Religious Freedom" riverasoto is waiting for your help

Explanation:

Answer 2

Jefferson argues that no human authority (civic or religious) should impose its religious views on individuals. Such impositions, according to Jefferson, “are a departure from the plan of the holy author of our religion,” and they “tend only to beget habits of hypocrisy and meanness” among the believers.

What are Jefferson's arguments for freedom of religion?

Jefferson believed that the Statute guaranteed religious freedom for “the Jew and the Gentile, the Christian and Mahometan, the Hindoo, and infidel of every denomination.” He believed that such broad freedom and tolerance were essential in a republic with people from different religions, ethnicities, and races.

Learn more about Act for Establishing Religious Freedom here https://brainly.com/question/2200062

#SPJ2


Related Questions

What is one service the Freedmen's Bureau provided for African Americans?
The agency provided funds to pay poll taxes.
The agency set up courts to settle land disputes.
The agency taught them how to cultivate crops.
The agency found employment in Northern cities.

Answers

Answer:

b

Explanation:

got right on edge

The agency set up courts to settle land disputes: is one service the Freedmen's Bureau provided for African Americans. Thus, option B is the correct option.

What were Freedmen's Bureau Acts of 1865 and 1866?

On March 3, 1865, Congress approved "An Act to Establish a Bureau for the Relief of Freedmen and Refugees" to give displaced Southerners, including newly liberated African Americans, food, housing, clothes, medical care, and land. The Freedmen's Bureau was tasked with running "during the present war of rebellion, and for one year thereafter," in addition to establishing schools, monitoring employment agreements between freedmen and employers, and overseeing seized or abandoned properties.

In the conflict between President Andrew Johnson and the radical Republicans in Congress over Reconstruction and the role of the federal government in integrating four million newly emancipated African Americans into the political life of the country, the fight to establish the Freedmen's Bureau and then to extend the legislation one year later played a significant role.

Learn more about Freedmen's Bureau Acts here:

https://brainly.com/question/14117703

#SPJ2

If the Supreme court states that a law is constitutional, can the same kind of law be written by other states?

Answers

Answer:

Yes, it works sort of like a mom and a parent. If the parent says its ok that she can eat in her room, then by that logic, the child can too eat in his room because the authority did it first.

Hope this helps!

(also note, i'm no expert on law and i'm also doing an exam, soo...yeah)

Will give brainliest:

A classmate asked me to send a pic of my Spanish assignment. I’m a nice person but how do I tell her no nicely? I don’t want to face consequences of plagiarism if she steals the answers. What do I do

Answers

Answer:

Just explain that you dont want to as you don't  want any trouble for either of you.You are under no obligation to give her your answers.

Explanation:

Just be honest that’s all it takes you don’t need to explain honesty goes a long way

Over-farming and the changed the face of farming on the Great Plains which caused Floods - high lake levels Drought - Increased home sales Drought - The Dust Bowl La Nina - the cruise ship​

Answers

Answer:

what are you even asking

Explanation:

List some of the external problems that China faced during the 1800s.

Answers

Answer:

Hope this helps

Explanation:

In the 1800s , China many major problems like for instant land shortages, famine, rural population. But, there was also heavy taxes and inflation. Their were the weakest country.

Answer:

In the 1800s China simultaneously experiences major internal strains and Western ... In 1894-5, Japan challenges and defeats China in a war over influence in Korea, ... By the late 1800s, China is said to be “carved up like a melon” by foreign ... the Qing imperial authority in 1911 in the name of a Republican Revolution.

Explanation:

This former slave had lived in a free territory with his owner. When his owner
moved back to a slave state he had passed away. Now this former slave is fighting
for his freedom.
1.Homer Plessy
2.Frederick Douglas
3.Dred Scott
4.John Brown

Answers

Answer:

i think it is homer dred scott

Explanation:

i think but may not be right so sorry if wrong

PLEASE HELP BRAINLEST AND 50 POINTS!!!!!!!!!!
In one or two paragraphs, explain why women struggled for so long to gain the right to vote in the United States. Make sure your answer includes a common social belief about women in the 1800s, an issue the women's rights movement had to overcome, and a legal barrier activists faced as they fought for voting rights.

Answers

Woman struggled because they were weak too ppl eyes

Which advancement most helped increase trade during the postclassical era? O A. More complex religions O B. More delicate pottery O C. More accurate compasses D. More sophisticated calligraphy​

Answers

Answer:

More accurate compasses

Answer:

More accurate compasses

Explanation:

write an essay about The first black president addressing the 6 W's
(who, what, when,where, why and how )


plz help giving brainliest

Answers

Answer:

are u going to ever help me

Explanation:

Which climate zone has mild temperatures, hot/dry summers and cool winters and covers 5% of the land

Savanna (Tropical Wet and Dry)
Tropical Wet (rainforest)
Desert
Mediterranean

Answers

Answer:

Tropical weather is a good place for a new

Mary lease was ___who spoke out in favor of banking and railroad reform?

-an alliance leader
-a grange leader

Answers

Answer:

An alliance leader

Answer:A

Explanation:

How did conflict develop between Spanish settlers and Native Americans in the Southwest?

Answers

Answer:Conflict developed between Spanish settlers and Native Americans in the Southwest in that the Native Americans began to fight over buffalo herds.

Explanation:Spanish leaders formed alliances with some of the Indian tribes and provided them with tools, crops, livestock, and arms. The new materials available to these tribes gave them superior weaponry over their enemies. As Indians acquired horses, they became more mobile.

How did the Iranian hostage crisis affect American opinion?
A. Americans suspected that the shah was pro-Soviet.
B. Americans were angry at Carter.
C. Americans supported the Ayatollah Khomeini.
D. Americans suspected the embassy staff were spies.

Answers

Answer:

B!

Explanation:

Jimmy Carter failed to save the hostages. leading Americans to be very upset and disappointed.

The Iranian hostage crisis affects the American opinion as Americans were angry at the carter.

What do you mean by opinion?

An opinion refers to any view or judgment formed about something.

The Iranian hostage crisis affect the American opinion as Americans were angry at Jim carter.

Therefore, B is the correct option.

Learn more about opinion here:

https://brainly.com/question/8530142

#SPJ2

Examine Item A in your test documents. Which municipal area most likely has
the least influence on elections due to the reapportionment shown?
A. Gardiner
B. Woodstock
C. Shawangunk
D. Rochester

Answers

Answer: Shawangunk

Explanation:

a pex

Due to the reapportionment, Shawangunk's municipal area probably has the least impact on elections.

What is Municipal election?Municipal election means an election or primary, either regular or special, in cities, villages, and incorporated towns."Municipality" means any such city, village or incorporated town.Municipal election means a general election, first election, by-election and a vote on a bylaw or question.

Town of Shawangunk--The Town of Shawangunk is led by a supervisor and a board of four council members. The current supervisor is John Valk, Jr., in office since 1998.The Town of Shawangunk (Town) is located in Ulster County and has a District that provides sewer services to the Hamlet of Wallkill and two correctional facilities: the Wallkill Correctional Facility and Shawangunk Correctional Facility which are operated by DOCCS.The Town is governed by a five-member elected Town Board (Board) composed of the Town Supervisor (Supervisor) and four Town Council members.

Learn more about Municipal Election on:

brainly.com/question/969142

#SPJ2

ARDS
>
How did Lincoln want to treat the Southern states after the war?


Answers

Answer:

Lincoln wanted to treat the south kindly and his main focus was to bring the states back into the union.

Explanation:

katangian ni Gilgamesh kung bakit siya itinuring na isang bayani sa Epiko.

Answers

Answer:

it means "Gilgamesh’s characteristic is why he is considered a hero in the Epic." or, nangangahulugang "ang katangian ni Gilgamesh ay kung bakit siya ay itinuturing na isang bayani sa Epiko."

Explanation:

the American genocide is an example of
a. diplomacy
b. a government using war as an excuse to commit atrocities on its own citizens
c. communist revolution
d. self determination

Answers

Answer:

B. A government using war as an excuse to commit atrocities on its own citizens.

Explanation:

I believe its this, but do you mean or armenian, because that might change the answer.

what was life like in the south for african americans before civil rights movement

Answers

Answer:

terrible!

Explanation:

In what city did nine African Americans go to school with an army escort?

A) Washington DC

B) Los Angeles, Ca

C) Birmingham, Alabama

D) Little Rock, Arkansas

Answers

Answer:

Little Rock, Arkansas.

Explanation:

What were some of Hideki Tojo's actions taken or policies put in place that would be classified as totalitarian?

Answers

Supporter of Nazi Germany.He advocated pre-emptive air strikes on both China and the Soviet UnionRacist supremacy of Yamato raceWomen had few rights opposition to western ideasManchurian Incident - invasion of Chinese Manchuria (real start of WW2)

What was the role of boys and men? Today, many people would strongly disagree with the Nazis' decision to make gender the basis for extreme differences in schooling. What stereotypes about girls and boys did the Nazi program rely on?

Answers

Answer:

Nazi leaders inspire young people in different ways.

Explanation:

After the Nazis came to power in 1933, they passed new laws related to public education. Nationalist and racial ideologies were some of the thing taught in schools. The regime made a special effort to reach young people. All youths between the ages of ten and eighteen were required to join the Hitler Youth. The Nazi schools known for their strict rules and no place for weaklings. The Nazi draws a difference between girls and boys, indicating girls for their naturally weak, and boys for natural strength. The Nazi program had stereotypical ideas about girls and boys as they believed girls to be breeders and boys to become soldiers. Co-educational schools were prohibited.

True or false: Paul revere was poor prior to the American revolution

Answers

Answer:

true

Explanation:

Revere died of natural causes on May 10, 1818 at the age of 83, leaving five children, several grandchildren, and many great-grandchildren. The son of an immigrant artisan, not born to wealth or inheritance, Revere died a modestly well-to-do businessman and a popular local figure of some note.

Please please help help please please help me ASAP ASAP please ASAP thank you so much
NO LINKS OR FILES

Answers

Answer:

Need to add a story i believe.

Explanation:

HELP ASAP PLS
——————
What wish did Zeus grant Eos????

Answers

Answer:

Zeus granted Tithonus immortality

Explanation:

How would she survive without her love? She could not imagine such a life, and so she asked the greatest god of all, Zeus, to grant Tithonus immortality. "Please," Eos pleaded, "let my beloved Tithonus live forever." Her eyes filled with tears, her skin flushed, and even Zeus was moved, and so he granted her request.

What is considered an emotional appeal against the holocaust?

Answers

Answer:

Austria's presidential election

Explanation:

Who was the first president of the Confederate States of America

Answers

Answer:

On November 6, 1861, Jefferson Davis was announced as president of the United States of America

Explanation:

He was the first President of the Confederate states of America.

hope this helps!

~mina

Answer:

Jefferson Davis.

Explanation:

Other Questions
Need help, please... Which limiting factor is this adaptation a response to 2. Which ethic do you think is most important for a journalist to have? Why? Write the relationship between cells, tissue and organs in human body.(plzzzzz answer correctly) At an auto repair shop. 3.5 hours of labour costs $311.50. What is the labourcharge for a 5 hour job? 4. How are the main narrator and Simon Wheeler different? Give as many details aspossible. What fossil helped support Wegener's hypothesis of continental drift?A. GondwanalandB. KannemeyeridC. MesosaurusD. Glossopteris 2What does Don Pepe's lesson to Nayeli in paragraph 13 reveal about theirrelationship?A. He was protective of her and did not want to worry her about life's difficulties.B. He thought she would be able to understand complicated ideas.C. He found her annoying and wanted to limit their conversations.D. He was interested in unusual trivia and wanted to share it with her. what is the mRNA in TACCGGATGCCAGATCAAATC? Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans why is it important to save energy in our daily lives Red and white blood cells are produced inside the __________ of bones. This is an interaction between the skeletal, circulatory, and immune systems.A. MarrowB. Spongy BoneC. Compact BoneD. Liver This Question: 1 pt20 of 20This QuthThe pH of a fruit juice is 2.9. Find the hydronium ion concentration, [H30 * ), of the juice. Use the formula pH = -log[H30*]The hydronium ion concentration [H30 + ] is approximately moles per liter.(Use scientific notation. Use the multiplication symbol in the math palette as needed. Round to the nearest tenth as needed.) A worldwide organization of academics claims that the mean IQ score of its members is 118, with a standard deviation of 17. A randomly selected group of 40 members of this organization is tested, and the results reveal that the mean IQ score in this sample is 115.8. If the organization's claim is correct, what is the probability of having a sample mean of 115.8 or less for a random sample of this size When riding your bike on a main road you should always follow the rules of the _________.roadbikers guidewalkerstown they are riding in Can someone please help me on this plz I beg u :( Writing: Critique On Nutrition And Pregnancy. Critique a current article or website on Pregnancy and compare to good nutrition practices. 1) Evaluate the recommendations. 2) Compare the recommendations. Write a 300 or more on your findings and conclusions. ( Will Mark Brainliest). Mhanifa Plz help me with this thank you! Need help on doing escape room. How to escape from Emoji Planet.