Answer:
The ecological effects of acid rain are most clearly seen in aquatic environments, such as streams, lakes, and marshes where it can be harmful to fish and other wildlife. As it flows through the soil, acidic rain water can leach aluminum from soil clay particles and then flow into streams and lakes
Explanation:
A small population will most likely
a. have plenty of food to eat. b. have exponential growth.
c. have plenty of space to live. d. All of these are correct.
Answer:
D. All of these are correct.
DNA is wrapped around
and condensed into chromosomes.
• Genes are used as a set of instructions to produce proteins.
Proteins affect the
and function of organisms.
Chromosome
Answer:
- DNA is wrapped around nucleosomes and condensed into chromosomes.
- Proteins affect the traits and function of organisms.
Explanation:
Nucleosomes are the basic unit of compaction of DNA. Each nucleosome is composed of ~148 bp double-stranded DNA and an octamer of histone proteins, which include two molecules of each core histone: H2A, H2B, H3 and H4. Subsequently, nucleosomes are packaged into chromatin fibers so they can be densely compacted into chromosomes. On the other hand, proteins are molecules that play important (structural and enzymatic) functions in a cell. These proteins may affect the structure/function of a cell, thereby affecting a certain characteristic/trait to develop.
FOODS HIGH IN PROTEIN RELEASES ENERGY
A. FAST
B. QUICKLY
C. SLOWLY
Answer:
quickly
Explanation:
Answer:
SLOWLY
Explanation:
using the graph, the temperature seasonal force from the other Forest biomes. choose all the apply
A) the temperature seasonal Forest averages 100 to 200 cm rainfall/year
B) the temperature seasonal Forest is cooler and wetter than the tropical rainforest
C) the temperature seasonal Forest has warmer average temperatures than the Boreal forest
D) the temperature seasonal rainforest has similar temperatures but less rain than the temperate rainfores
E) the temperature seasonal rainforest has similar rainfall to the Boreal and tropical seasonal rainforest, but is much warmer than either one
Answer:
The correct answer is - A and C,
Explanation:
According to the graph, the following conditions are matched correctly with the temperature seasonal forest with other biomes:
The temperature seasonal forest has the precipitation range from 50 cm to 250 cm rainfall per year approximately. The average rainfall from this would be 150 cm/year or between 100 to 200 cm per year.
B. the temperature seasonal forest has a temperature between 15 degrees Celsius to 20 degrees celsius which is warmer than the boreal forest that has a temperature between 0 to 15 degrees Celsius approximately.
Answer:
A, C, D
Explanation:
¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?
Answer:
La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:
islfso lufe
(Hint: a non-renewable resource, like coal)
CHAPTER
1 what is the term?
Answer:
Fossil fuel
Explanation:
which involves producers, consumers, and decomposers?
the water cycle
nitrogen fixation
evaporation
the carbon and oxygen cycles
Can someone tell me if it’s correct
Answer:
yes ur right
Explanation:
The Rio Grande River separates Mexico from Texas.
What most likely created the riverbed?
A.glaciers
B.plate collisions
C.volcanoes
D.water erosion
Answer:
d I think or b?
Explanation:
water could cause it to form a river and spread over time
plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.
Help me please please help me
Answer:
The first one
Explanation:
A thesis is a statement or theory not a question.
Will give Brainliest within five minutes of answer - Why do we want to explore Mars more than the other planets/moons even though it is not currently habitable (with its temperatures, atmosphere, etc.)? How can it be habitable?
Answer:
After the Earth, Mars is the most habitable planet in our solar system due to several reasons:
Its soil contains water to extract
It isn’t too cold or too hot
There is enough sunlight to use solar panels
Gravity on Mars is 38% that of our Earth's, which is believed by many to be sufficient for the human body to adapt to
It has an atmosphere (albeit a thin one) that offers protection from cosmic and the Sun's radiation
The day/night rhythm is very similar to ours here on Earth: a Mars day is 24 hours, 39 minutes and 35 seconds
The only other two celestial bodies in orbits near the Earth are our Moon and Venus. There are far fewer vital resources on the Moon, and a Moon day takes a month. It also does not have an atmosphere to form a barrier against radiation. Venus is a veritable purgatory. The average temperature is over 400 degrees, the barometric pressure is that of 900 meters underwater on Earth, and the cherry on top comes in the form of occasional bouts of acid rain. It also has nights that last for 120 days. Humans cannot live on Mars without the help of technology, but compared to Venus it's paradise!
Additional info:
Mars is an obvious target for exploration because it is close by in our Solar System, but there are many more reasons to explore the Red Planet. The scientific reasons for going to Mars can be summarised by the search for life, understanding the surface and the planet’s evolution, and preparing for future human exploration.
Searching for life on Mars
Understanding whether life existed elsewhere in the Universe beyond Earth is a fundamental question of humankind. Mars is an excellent place to investigate this question because it is the most similar planet to Earth in the Solar System. Evidence suggests that Mars was once full of water, warmer and had a thicker atmosphere, offering a potentially habitable environment.
Select the correct answer. Which statement about natural selection is true? A. Natural selection and evolution are two terms for the same phenomenon. B. Natural selection is an outdated theory to explain how evolution took place. C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce. D. Natural selection is the process by which organisms develop variation in traits, which gives them a better chance of survival.
Answer:
C. Natural selection is the process by which organisms with more beneficial traits are more likely to survive and reproduce.
Explanation:
Natural selection is an evolutional process by which species of living organisms with stronger or more beneficial traits have higher chances of survival and reproduction. In other words, it is the process by which organisms adapt and survive.
Organisms in a population are all different in their own ways. And those with characteristics or traits better suited for the environment are more likely to survive than those without. The selection prefers more beneficial traits and not wholly on the superiority of the organism. So, the survival and reproduction chance of an organism depends on the presence of traits beneficial to the environment, which is how nature selects. And in this process, those selected will dominate the population while those rejected will be reduced or even die.
Thus, the correct answer is option C.
If a population is evolving, the allele frequency ________
Marcus grew three rosemary plants. He put one in
direct sunlight, one in the shade, and one in the
dark. The plant in the sun grew the most quickly
and looked the healthiest. Marcus concluded that
rosemary plants grow best in the sun.
How would you evaluate Marcus's conclusion?
O A. His conclusion is valid because his
experiment included a control.
B. His conclusion is valid because he tested
only one variable.
O C. His conclusion is flawed because he did
not perform enough trials.
O D. His conclusion is flawed because it is
based on the appearance of the plants.
Answer:
His conclusion is flawed because he did
not perform enough trials.
Explanation:
i jus took the test
What two types of consumers are missing from this pyramid?
Please help I need to turn it in today !!!!
Answer:
decomposers and omnivores
Explanation:
Explain the lifecycle of mosquito in short
Answer:
Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)
tRNA uses (anticodons/codons) to match to the mRNA.
Answer:
anticodons
Explanation:
codons are for mRNA
tRNA uses anticodons to match to the mRNA.
Which one does tRNA uses?tRNA (transfer RNA) molecules are responsible for carrying specific amino acids to the ribosomes during protein synthesis.
They have an anticodon region that consists of three nucleotides that are complementary to the codons on the mRNA (messenger RNA). The codons on the mRNA determine the sequence of amino acids in the growing polypeptide chain.
The anticodon on the tRNA base pairs with the complementary codon on the mRNA, ensuring that the correct amino acid is incorporated into the growing protein chain. The matching between the anticodon and codon is essential for the accurate translation of genetic information into protein synthesis.
Learn more about tRNA at:
https://brainly.com/question/4089622
#SPJ6
What are the factors that determine
the level of harm an introduced chemical
has on the enviroment?
PLEASE ANSWER QUICKLY
Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)
what are cotyledons? & what is its use
Answer:
Cotyledon, seed leaf within the embryo of a seed. Cotyledons help supply the nutrition a plant embryo needs to germinate and become established as a photosynthetic organism and may themselves be a source of nutritional reserves or may aid the embryo in metabolizing nutrition stored elsewhere in the seed.
*You Can put this in your own words
Hello! could someone please do a 4 sentence quark poem
Answer:
Quark is a character in the television series Star Trek: Deep Space Nine.
Quark developed a few strong friendships during his stay on Deep Space Nine.
The Ferengi have business deals throughout the galaxy; Quark is no different.
For vegetarians, soft cheeses like cream cheese and quark do not contain any rennet at all.
Explanation:
This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism
Answer:
A. Mutualism
Explanation:
The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
Which process begins the formation of sedimentary rock?
Carbon dioxide enters a plant through pores (openings) called the
A. stomata.
B. cuticle.
C. veins.
What organisms are capable of cellular respiration?
A. Heterotrophs only
B. Animals and fungus
C. Animals, fungus, and some bacteria
D. Protists
E. All organisms
what does the respritory system do?
Answer:
The respiratory system's main job is to move fresh air into your body while also removing waste gases.
Explanation:
Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.
The term used to describe a location with many different cultural groups is
A. culturally diverse
B. globalization
C. multiple perspectives
D. ethnicity
Please help i am giving away brainiliest
Describe the Lytic cycle.
No dam links
Answer: here ya go
Explanation: The lytic cycle is one of the two cycles of viral reproduction
Answer:The lytic cycle (/ˈlɪtɪk/ LIT-ik) is one of the two cycles of viral reproduction (referring to bacterial viruses or bacteriophages), the other being the lysogenic cycle. The lytic cycle results in the destruction of the infected cell and its membrane.
Explanation: