How do you spell these sentences to French?

How Do You Spell These Sentences To French?

Answers

Answer 1
Seulement toi aujourd'hui?

“S’il vous plaît suivez-moi. Voici votre menu.”

Pour bois? voici ta boisson. Est-que-tu prêt à commander?

Voici ton nourriture.

Voici votre chèque. Merci pour arrivant.

Related Questions

Fill in the blank with leur, leurs.

Monsieur Battle est ____________ Assistant principal

Answers

Answer:

Explanation:

Bonjour,

Monsieur Battle est ___leur _________ assistant principal.

Translate the following sentences into French.

18. I would also like to take your temperature.

19. I am prescribing a cough syrup.

20. You should buy some tissues.

PLEASE DON’T USE THE TRANSLATOR

Answers

Hi,

18. Je voudrais aussi prendre votre température.

19. Je vous prescris un sirop contre la toux.

20. Vous devriez acheter des mouchoirs en papier.

:)

What gets capitalized in French and what doesn't? Thanks.

Answers

Answer:

The first letter of a Sentence, the first letter of a city , country, proper noun.

Explanation:

I speak french

Other Questions
HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. what is the mRNA in TACCGGATGCCAGATCAAATC? a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. Dr. Seals borrows $15,000 to remodel her backyard. The interest rate is 3%. The interest is compounded twice a year for two years. HELP! Ill mark you brainliest! Find the area of the irregular figure. Why would an investor want to choose a certificate of deposit over a corporate bond Please help help me please ASAP I am begging someone please No links or files describe how the state of Washington and its residents played a huge part in winning World War II? Plzzz help NEED THIS FAST!!! Which are affected by the factors of production? Choose three answers.the demand of the itemthe availability of the itemthe cost of the itemthe quality of the itemthe popularity of the item Please help. How do you graph the inequality of x -2 on a number line? And is it an open circle or closed? What's the circumference of a circle with a radius of 10 inches Explain the lifecycle of mosquito in short A 45 foot ladder is set against the side of a house so that it reaches up 27 feet. If Latanya grabs the ladder at its base and pulls it 3 feet farther from the house, how far up the side of the house will the ladder reach now? (The answer is not 24 ft.) Round to the nearest tenth of a foot. Layla is going to invest $5,200 and leave it in an account for 15 years. Assuming the interest is compounded monthly, what interest rate, to the nearest tenth of a percent, would be required in order for Layla to end up with $13,800? fateful journey what elements of the story did he invent? And what did he alter ? The modern women's movement arose as more womena questioned their roles in society.b. applied for civil service jobs.C. worked in the home.demanded equal voting rights.Please select the best answer from the choices provided DYes Most Americans consume a varied diet. They eat foods that are both plant- and animal-based. Which words are clues to the meaning of the word consume? A. are both B. eat foods C. animal-based D. Most Americans