How can you find the length of side FH? What is its length as a square root?

How Can You Find The Length Of Side FH? What Is Its Length As A Square Root?

Answers

Answer 1

Answer:

is it 1/2absinc

Step-by-step explanation:

Answer 2

Answer:

[tex]\sqrt{34}[/tex] units

Hope thi helps.


Related Questions

Pls help me I’ll give you 15 points

Answers

Answer:

number one is i thinks 10000000

Step-by-step explanation:

What is the equation of the line through the points (4,6), (8,12), and (10,15)?

Answers

y = 3/2x is the answer for this problem.

It easy i just don't pay attention in class so I don't know the answer

Answers

I think the answer is J
Y = 7
You could also use
Geo calculator to make it easier.
You’ll just have to write the point and the choices.

As mindy flies her kite, the distance from the kite to the ground increases, as shown in the graph below.

Answers

Answer:

25 (c)

Step-by-step explanation:

Ralph and his brother are at a carnival. They separate from each other at the Ferris wheel at 1:00 PM, and they agree that they will each meet back at the Ferris wheel from time to time to see whether the other is ready to leave. Ralph checks the Ferris wheel every 10 minutes. Joe checks in every 12 minutes. At what time will they meet at the Ferris wheel again. (Hint: Don’t forget you’re looking for a time.)

Answers

Answer:

3:00PM please mark me brainliest and thank me

Step-by-step explanation:

you have to find the lowest common multiple between 12 and 10 and that is 120 and 120 minutes is 2 hours. So 1:00 PM+ 2 hours= 3:00 PM

Answer:

2:00pm

Step-by-step explanation:

1pm separated

= 12 x 5 = 60 minutes

1+1hr = 2nd hr = 2:00pm

Once again Looking for the sum of all the answers, also need to round the neatest tenth. I got 11 but somehow it was wrong. Pls help quickly

Answers

Answer: x=6/5 which is 1.2

Step-by-step explanation: I think I'm not too sure which one you were taking about

See attachment for question, please help asap

Answers

Answer:

7/256

Step-by-step explanation:

an = a1 * (1/2)^n-1

a9 = 7(1/2)^9-1

a9 = 7(1/2)^8

a9 = 7/256

Find the interquartile range (IQR) of the data set.

Answers

Answer:

IQR = 157.5

Step-by-step explanation:

Q1 = 518.5

Q3 = 676

Equation = 676 - 518.5 = 157.5

Hope this helps!

it’s 157.5 i hope this helped :)))

You buy a backpack for $34.82. The tax is 9.25%. How much taxes do you pay?

Commission:

Answers

Commission would be : 38.04
34.82*9.25= 322.08/100 = 3.22
comission : 34.82 +3.22 = $38.04

A scalene triangle has an angle that measures 47∘ and a second angle that measures 88∘. What is the measure of the third angle?

Answers

Answer:

45°

Step-by-step explanation:

The angles of any triangle add up to 180 degrees

add the two known angles: 47+88=135

then subtract the sum from 180 to get answer: 180-135=45

Answer:

45

Step-by-step explanation:

In a triangle the angles add up to 180 degrees. So, we can subtract 47 and 88 from 180. The result, 45, will be your final answer.

Find the missing angle in a triangle with the given sides.

Answers

Answer: 72 degree

Step-by-step explanation:

By Angle Sum Property,

53 + 100 + angle C = 180

153 + angle C = 180

angle C = 180 - 153

       =    72 degree

Hope it helped u,

pls mark as the brainliest        - Ayaan707 for help -

^_^

Answer: 27

Step-by-step explanation:

The full triangle has to equal 180

the distance between two towns is 120 kilometers.There are approximately 8 kilometers in 5 miles.which measurement is closer to the town.
A.75MI
B.3mi
C.192mi
D.117mi

Answers

Answer:

A I believe

Step-by-step explanation:

Answer: A

Step-by-step explanation: 75 divided by 5 is 15 and 120 divided by 8 is 15 so 75 miles is the closest measurement

Please help! Only have a few minutes left to answer before it's waaay too late! It's the final extension!

Answers

4.63 x 3 = 13.89 (3 hotdogs and 6 bags of chips)
18.39 - 13.89 = 4.5 (2 hotdogs)
4.5 divide by 2 = $2.25

Answer:

4.63 x 3 = 13.89 (3 hotdogs and 6 bags of chips)

18.39 - 13.89 = 4.5 (2 hotdogs)

4.5 divide by 2 = $2.25

the answer is for one hot dog it is x= $2.25

Step-by-step explanation:

study hard and dont give up on anything, i hope you have a amazing day ❤️

T-shirts cost $11 each. Raphael graphs the relationships that give the cost y in dollars of buying x T-shirts. Which ordered pair is a point on the graph of the relationship?
A(0, 11)
B(2, 22)
C(3, 14)
D(5, 16)

Answers

The answer is B(2,22).
Since 1 shirt costs 11 dollars, 2 shirts will cost 22 dollars. Hope this helps!

Kelly's Cafe offers two kinds of espresso: single-shot and double-shot. Yesterday afternoon, the cafe sold 4 single-shot espressos and 6 double-shot espressos. What percentage of the espressos sold were single-shot?

Answers

Answer:

40% of espresso was single-shot.

Step-by-step explanation:

To make a percentage, you need to think of a fraction first. The denominator is always 100 in a percent. If my answer is 40%, the fraction would be 40/100. If there was 6 double shots and 4 single shots, those two together would make 10. 10 x 10 is 100. So really, you just have to multiply 4 by 10 to get the percentage.

Hope this helped, if your confused, just ask me :]

-Nific 0.9

No links!!!

A stalactite is a mineral formation that hangs from the ceiling of a cave. A cone shaped stalactite has a height of 48 centimeters and a base circumference of 3.5pi centimeters. What is the volume of the stalactite? Round your answer to the nearest whole number.​

Answers

Answer:

615.75cm

Step-by-step explanation:

The area of the triangle below is 33.62 square feet. What is the length of the base?

Answers

Answer:

8.2 ft

Step-by-step explanation:

33.62 * 2 / 8.2 = 8.2 ft

Answer: 4.1

Step-by-step explanation:

33.62 ÷ 8.2 = 4.1

Mariel wrote these checks from her checking account: $10, $10, $31, and $10. Which number shows the change of balance in her checking account?
A. -$61
B. -$1
C. $1
D. $61

Answers

$61 o hope it helps

Ethan has a job mowing lawns in the summer. He is dedicated to putting 35% of his income back into his business account. Last week he put $28 into his business account, how much money did he make last week?

Answers

8-3y < 41 I think that’s the answer

SHOW YOUR WORK

Can someone help?
(no files or links)
(Will give brainliest)

Answers

2 1/3
You would do 6 3/4- 1 3/4=5
5-1 1/3= 2 2/3

The question is in the picture!

Answers

i think the answer is wanting us to write a equation. perimeter is where you add you on the outside so in this case it would be, x + x + x

Answer:

82 or 5.3

Step-by-step explanation:

As you know a whole triangle is 180° so if you subtract 16 from 180 you get 164 so then you just divide it by three and you get 54.3.

Or if that is wrong try dividing 16 into three and you get 5.3.

I'm really sorry if neither one of these are right!

help again? :(


''Create your own word problem where the answer is ⅝. It should be solved using multiplication''

Answers

Answer:

Hi, your answer will be 5/8 x 2/8.

Step-by-step explanation:

When multiplying fractions, you are to do both the numerators and denominators. So, if you do 5/8 x 2/8, that would result as 10/16. When you simplify, that would be 10/16 divided by 2, which is 5/8.

Hope this helps! :)

The answer is 5/8 x 2/8

PLEASE HELP I WILL GIVE YOU 5 STARS, THANK YOU, AND GIVE BRAINLIEST TO FIRST ANSWER

Answers

Answer:

I think it's figure B

Step-by-step explanation:

Over the y axis it would be in the quadrant where figure A is then move it three units down. It could only be B. For C it is reflected over the x axis so that can't be it.

Answer:

The answer is B. You're welcome!

help? :)

What fraction multiplication sentence could this model represent?

Answers

It’s not letting me see the picture
It depends on what u are currently learning on fraction like what category and then I will try to answer in the best way I can in the comments

SOMEONE HELP PLEASE I WIL GIVE BRAinlest could yu please help answer 1-9 and I would really be grateful if you explained how you did you please I really need help and please actually answer and don't just answer nonsense when you answer actually help cause nobody's going to help you if you do that to other people

Answers

Answer: For the first one, 12.5% chance

Step-by-step explanation:

The probability of flipping a coin and getting tails is 50%. Then, if you were to flip two coins and get both tails, you would have to divide the 50% by 2, which is equals to 25% of flipping two coins and getting them both tails.

So now we know...

Flipping one coin gives you 50% tails and 25% of flipping two coins and getting two tails

So now, we do it again with the third coin. We would divide the 25% by 2, which will get us to a 12.5% of getting all tails, or in fractions, 1/8

I’m not exactly sure about the other ones but I hope you found this one helpful!

1. It’s easiest to visualize if you write down all of the options that are possible when flipping a coin 3 times.
TTT
TTH
THT
THH
HHH
HHT
HTH
HTT
(i believe thats all of the options, if not adjust as needed)
but TTT is 1 out of the 8 possibilities, making the probability of getting three tails 1/8 or .125

2. There are two possibilities for getting a sum equal to three with two dice being rolled. Rolling a 1 and rolling a 2 or rolling a 2 and rolling a one.
You have 36 different combinations total, making your fraction 2/36

2/36 still needs to be simplified by dividing by two

your answer is 1/18 or .55555 repeating

3. There is no black section on the spinner so there is no way to land on a black section. The probability is 0

4. I believe this question is asking about the theoretical probability of flipping a coin, which is 1/2 or .5

5. You’ve got a theoretical probability of 3/6 or 1/2 chance to roll less than a four. If you roll the cube 24 times, you should expect to get 12 (half of 24) rolls less than four.

6. The probability of choosing a red marble is 5/30 or 1/6. The marbles are always replaced so your probability doesn’t change.

Noah pulls 60 marbles out and replaces them. 1/6 of those marbles should be red.

1/6 of 60 is 10

10 marbles should be red

7. There are 11 balls total. 5 of those are green (5/11), 3 of them are red (3/11), 2 of them are white (2/11), and 1 of the balls is orange (1/11).

The probability of choosing an orange ball (the least occurring) is 1/11 or .090909 repeating

8. Adrian has a 1/4 chance of being put in any singular section. He volunteers 20 times. We’re trying to figure out how many times he was put in either the cat or the reptile section.

If we add the probabilities of the cat and reptile assignment, you get 1/2.
1/2 of 20 is 10

Keeping the probabilities separate and adding the occurrences together at the end will give you the same answer.
1/4 of 20 is 5
Add another 1/4, which is 5+5 and it’s 10

9. Let’s label the four sections on the spinner 1, 2, 3, and 4. The outcome of the coin flip will either be heads or tails.

The combinations could be:

1 H
2 H
3 H
4 H
1 T
2 T
3 T
4 T

That totals to 8 possible outcomes.

You can multiply the two outcome numbers together to achieve the the same answer:

2(4) = 8

HELP
The perimeter of a hexagon is 30x and the perimeter of a triangle is 10x + 40. If the two figures have the same perimeter, what is the value of x?

Answers

the answer:
x=2
explanation:
30x=10x+40
-10x -10x
----------------
20x=40
---- -----
20 20

x=2

Please answer the question DON'T ADD LINKS OR I WILL REPORT

Answers

Im pretty sure it’s B because it tells your the area which is 40 and the length which is 4. I don’t know how to explain it but hopefully it kinda of helped and it’s right.
It’s D.

Explanation: Since the area formula is A = bh/2, you would replace the variables with what you know. Since we know that the base is 4 and the area is 40, your equation would be 40 = (4)(h)/2. To solve, you would simplify the (4)(h)/2 to 2h because 4 divided by 2 is 2. You’re left with 40 = 2h and then you divide by 2 to get h by itself, 40 divided by 2 is 20, therefore the height is 20 inches.

I need help solving this please

Answers

Answer:

2.5 miles i think

Step-by-step explanation:

Answer



2.5




Reasoning :



a) A number is greater than -4 and less than 9. What is the least integer value of this number?
b) What is the greatest possible integer value of this number?

Answers

Answer:

5

Step-by-step explanation:

because of you use a number line -4 is 5 points away from 9

Positive

5 because you use a number line

find the perimeter of a rectangle with a length of 4x + 2 and a width of 2x

16x + 8
10x + 4
12x + 4
8x + 2

Answers

Answer:

12x+4

Step-by-step explanation:

To find the perimeter of any shape you just have to take the sum of all the sides.

In this case you would write:

 4x+2 (side 1) +2x (side 2) +4x+2 (side 3) +2x (side 4)

Now you just have to simplify the expression which would give you:

12x+4 (after collecting like terms)

So the final answer will be 12x+4

4x+2+2x=6x+2 which is the same as 12x+4
Other Questions
Mason wants to play with Maliyah's Doll House, but first he needs to stop at the clubhouse. If allthree stops are in the shape of a triangle, which of the following distances would NOT be an option? Which of the following is a true statement about ecology?Ecology is the study of relationships of living organisms and their environment.Ecology is the study how animals adapt to their environment.Ecology studies how living organisms have changed over time.Ecology studies the difference between living organisms. How do friends and peers impact on your sexuality The sum of three consecutive integers is -27 what is the product of the smallest and largest of the three integers? what is the mRNA in TACCGGATGCCAGATCAAATC? pinocchio says my nose will grow. will it grow or not?dun dun dun what is (-10,10) if i dilate it by 1/2 a cup of coffee is left to cool inside a room and its cooling can be described by the function y = 85(.75)x/5 + 15 where x is time in minutes and t is the temperature of the coffee in degrees celsius. The height of a cylinder is 8 centimeters. The circumference of the base of the cylinder is 20 centimeters. Which measurement is closest to the volume of the cylinder in cubic centimeters? Help!!! I do not seem to understand this problem well. HELP MEEE BRAINLIEST do this for me? helppp all my point I need help please!! Suppose we want to choose 3 objects, without replacement, from the 4 objects pencil, eraser, desk, and chair.(a) How many ways can this be done, if the order of the choices is relevant??(b) How many ways can this be done, if the order of the choices is not relevant? DUE RIGHT NOW PLEASE HELP!!!!! Clasifica cada uno de los siguientes incisos como sustancia pura (elemento y compuesto) o mezcla (homognea y heterognea). Explica brevemente. (a) arroz con leche (b) agua de mar (c) magnesio (d) gasolina ?????????????????????????? What does an individual's effective tax rate indicate?A.the average income earnedB.the average tax rateC.the minimum tax rateD.the next year's tax rate need help please hurry the person above me is usless