hii please help asap ill give brainliest thanks

Hii Please Help Asap Ill Give Brainliest Thanks

Answers

Answer 1

Answer:

the teachings of buddha

Explanation:

Answer 2

Answer:

C?

Explanation:

Sorry if im wrong


Related Questions

List at least TWO things Rosa Parks did after the bus boycott which continued to help th Civil Rights movement?


Please help me

Answers

Answer:

Parks and her husband lost their jobs after the boycott

Soon after the Montgomery bus boycott began, Parks lost her job as a tailor's assistant at the Montgomery Fair department store. Her husband Raymond also had to leave his job as a barber at Maxwell Air Force Base because he'd been ordered not to discuss his wife.

Explanation:

I just know :)

In upholding Louisiana’s Separate Car Act, the Supreme Court claimed that

Answers

Answer:

The court claimed that this issue was social equality not political or legal equality

Which of the following would NOT be within the powers of Congress according to the Constitution?
1. Removing the President from office for committing a crime.
2. Declaring war on other countries.
3. Making treaties with foreign countries.
4. Creating a law that raises taxes to build a bridge.

Answers

Answer:

3.

Explanation:

The power not vested to Congress by the United States Constitution is making treaties with foreign countries.

According to Article 2, Section 2, Clause 2, of the US Constitution, also known as Treaty Clause, gives power to the President of the United States to make treaties with foreign countries.

Therefore, option 3 is correct.

Amanda wrote an article about a controversial subject for her high school newspaper. Her principal said the article could not be published.

Which case did he most likely use to justify his decision and why?

A) He used Brown v Board of Education because the Supreme Court decided that Brown could not publish information about civil rights if it was deemed inappropriate by the publisher.

B) He used Miranda v. Arizona because the Supreme Court decided that a school administrator could decide if published information agreed with the school's educational mission.

C) He used Tinker v. Des Moines because the Supreme Court would not allow students to express their beliefs and opinions at a public school.

D) He used Hazelwood v.Kuhlmeier because the Supreme Court stated that a school administrator can censor material published at a school.

Answers

He most likely used tinker v Des Moines because he would claim that schools aren’t allowed to censor the opinions of students.

Answer:

He most likely used tinker v Des Moines because he would claim that schools aren’t allowed to censor the opinions of students.

Explanation:

How does the USA practice Imperialism now?

Answers

Answer:

what is imperialism, fr i wanna know what imperialism is can someone tell me

Explanation:

Armed with all of the knowledge that President Truman and his advisors had accumulated, how would you have ended the war in the Pacific?

Answers

Answer:

Truman stated that the United States had the weaponry to destroy Japan if it did not agree to his ultimatum. Truman also said the United States would destroy Japan to end the war.

Explanation:

Marina’s parents were going out for the evening. Before they left, they reminded 15-year-old Marina not to leave the house. Since Marina knew her parents would be out late, she had a plan to sneak out to be with some friends for a couple of hours. She found her mother’s car keys and drove her car. They all met at the mall, and it wasn’t long before the girls challenged each other to shoplift. Marina knew it wasn’t right but thought she could get away with it. They split up and promised to meet back at the same spot in 30 minutes with their items. It was only minutes later that Marina was caught walking out of a store wearing a sweater she didn’t pay for.

Which of Marina’s behaviors were unruly?

driving her mom’s car
taking her mom’s keys
disobeying her parents
being caught shoplifting
just pick on..? lol

Answers

Answer:

i think its driving without a license and shoplifting  

Explanation:

Answer:

disobeying her parents

taking her mom’s keys

leaving the house

Explanation:

these are unruly behaviors. these would NOT be criminal offenses for ADULTS if an adult committed this (adult = person 18 or over)

driving without a license, and being caught shoplifting are delinquent behaviors because they are illegal for adults and juveniles.

I had the delinquent question for me

State TWO functions of the legislature apart from making laws.

Give TWO reasons why a country needs laws.

Answers

Answer:

1 Reason is to keep order and balance. 2 is to keep citizens safe from govt oppression.

What is a major factor in the decline of some occupations, such as those in the textiles and clothing industries?

A) shifting consumer tastes
B) overseas labor costs
C) changing technologies
D) aging populations
I think it's C but I don't know

Answers

Answer:

The answer is C you are correct

Bethany says that she likes dark chocolate more than white chocolate. Why is her statement considered a personal perspective? A. She is stating evidence B. She is giving her opinion C. She is avoiding an opinion D. She is trying to hurt someone's feelings​

Answers

Answer:

B. she is giving her own opinion.

Explanation:

a personal perspective isn't a factual answer

what did the scholars that published theories on religions stipulate​

Answers

Answer:

Tylor in Primitive Culture. Psychological theories of the origin of religion take their departure from the work of Sigmund Freud (1856-1939). His general position on religion is found in The Future of An Illusion (1928) and Moses and Monotheism

1. Why did people call General Scott's plan of attack The Anaconda Plan?

Answers

Explanation:

Began with a powerful move down the Mississippi River to dominate it and eventually split the Confederacy into two parts. It was called the Anaconda to resemble how the Union planned to choke the Confederacy, just like and Anaconda chokes it's prey

What is the purpose of the poster? And who is its intended audience? Why was this message required?

Answers

Answer:

The purpose of posters are to educate and create awerness on what is happening on a topic.

Intended audience are the passer-by and those who stumble upon it online and children and those who practice them e.g a poster about what happens to those who smoke.

Like I said to educate and teach on the dangers of doing them.and also for awerness

Explanation:

What is the value of the digit 4 in this number? Write your answer in number form. 283,234,853,023

I have asked this question in math twice alr but people keep putting links
brainliest for the first person that gives the right answer

Answers

Answer:

4 million

or

4,000,000

The question says in number form so use the second one. Also, it's quite simple... just put the number and then one 0 for every number after it. In this case the 4 has 6 zeroes after it.


Describe the two major political parties in the United States and explain their
ideas about how the country should be governed.

Answers

Answer:

The Republican Party believes in a small government and low taxes. They are mostly nationalist. they are right wing. The Democratic Party believes in larger  government and high taxes on the rich. They are liberals/ left wing.

Explanation:

haha i was about to answer this but the person above me did first me lol anyways the person above me is correct

How does the economic system of the USSR differ from that of America?

Answers

Answer:The U.S. and the Soviet Union had different ideas about how to run an economy (business) and government. The U.S. believed in Capitalism – a system where ordinary people and businesses control the production of goods and services. ... The Soviet Union influenced Eastern Europe, while the U.S. influenced Western Europe.

Explanation:

Answer:

The USSR believed in communism while America in capitalism.

Communism means:

Everyday people don't control the mass production of goods and services for the people, but instead, everyone in the community contributes and receives according to their needs. Everyone gets everything equal; including payment, food, houses, and resources.

Capitalism means:

Everyday people and businesses control the mass production of goods and services for the people, not the government. Here, people control and own their own private properties. Everyone doesn't get anything equal; one person can get paid millions, have many houses, and eat luxurious foods, while another person can get paid minimum wage, have a small house, and have barely any resources to live off of.

Final note:

For economy, the U.S's was way (and still is) more advanced than the USSR.

which statement about counties is most accurate?

Answers

Answer:

Counties often manage institutions and services like jails, libraries, and courts.The  county commissions, county court, county legislature county executive or county administrators usually oversee the day-to-day operations of the county government. They are in charge of running various institutions including the jails and courts.

Explanation:

now please help me bro come on

Answer: In most states, each individual county has its own government.

Which of the following were the first two capitals of the United States?
O A. Washington, D.C. and Philadelphia
OB. Plymouth and New York City
O
C. New York City and Philadelphia
O
D. Washington, D. C. and New York City

Answers

Answer:

d i think but i dont know for sure

_______ is a system in which both matter and energy flow into and out of the system.
A.
A dynamic system
B.
A closed system
C.
An isolated system
D.
An open system

Answers

An open system, it’s the most logical response

George W. Bush was the first president to have a

Answers

Answer:

im guesing a oil buisness im not sure

Explanation:

Answer:

George Walker Bush (born July 6, 1946) is an American politician and businessman who served as the 43rd president of the United States from 2001 to 2009.

Explanation:

What is a right given to citizens that people have been talking about in the news?
will give brainly

Answers

Answer:

Not sure of this answer but I suppose it could have to do with mask wearing. There are constant talks about how much people have to contribute to the pandemic through social distancing, wearing masks, and doing our best to contribute to the global well-being. There is huge debate about whether low risk people really should be restricted or not. People are constantly questioning authority on this topic as well since thy are not sure who to believe. Just to clarify, the right given in this case, is our ability to still go outside our houses while wearing masks and not being extremely restricted.

Which part of the story shows how Kiara and Tanya's differences affect their friendship?
Kiara and Tanya were the best of friends. When they were 10 years old, they always went everywhere together. All their friends knew that if they found one of them, they would find the other. Anyone who didn't know them thought that they were twins because both Kiara and Tanya had long, silky red hair and pale complexions. They were even similar in height and build. They were more like sisters than friends.

But as similar as they were in appearance, they were just as different when it came to their personalities. This difference didn't affect their friendship, at least not for a long time. Kiara always got out and participated in activities and competitions. Tanya was happiest when reading a book at home. Kiara was outgoing and talkative. Tanya was quiet and shy. Kiara was popular, and people were drawn to her because of her ability to make quick friends. Tanya hardly had any friends besides Kiara.

As they grew older, Kiara managed to make a large group of friends. Tanya, on the other hand, still remained shy and reserved. This difference in their personalities eventually caused a rift between the two friends. Tanya would refuse invitations to parties and movies that Kiara invited her to. She just didn't want to hang out with people she didn't know that well. Kiara couldn't understand why. She thought Tanya disliked her friends.

Eventually, Kiara and Tanya both realized that they had outgrown one another. They still remained friends, but they were not as close as they once had been.

Answers

Answer:

As they grew older, Kiara managed to make a large group of friends. Tanya, on the other hand, still remained shy and reserved.

(I may not be right)

Explanation:

Answer:

As they grew older, Kiara managed to make a large group of friends. Tanya, on the other hand, still remained shy and reserved. This difference in their personalities eventually caused a rift between the two friends.

Explanation:

See the picture :D (Edmentum)


Billy Glaze was convicted because he was

Answers

Answer:

Glaze was arrested on August 31, 1987 while driving under the influence of alcohol, for a violation of his parole from a Texas conviction for crime in 1974. The arresting officers found a bloody shirt, crowbar and nightstick in his truck.

Explanation:

Mark me brainliest!

How was ancient Greek democracy different from American democracy today?

A. Everyone did not always agree.
B. Strong speakers influenced others.
C. People could speak their opinions.
D. All citizens voted on every issue.

Answers

Answer:  

i think it’s d

In Athenian direct democracy all citizens voted and in an American representative democracy citizens vote for representatives to vote for them.All citizens voted in an ancient Athenian democracy and in a modern American democracy citizens vote for representatives to vote for them.

It’s C because they said their opinions

True or false
In an autocratic government people select a representative in legislative to elect the president

Answers

Answer:false

Explanation:

Autocratic government is by one leader

A person who is working part-time when full-time work is desired is known as __________.
please help

Answers

Answer:

Underemployed

A person who is working part-time when full-time work is desired is known as underemployed.

Explanation:

Answer:

underemployment.

Explanation:

hope this helps:)

What does school choice refer to?


Families choosing the type of schooling their children will receive, such as public, private, or homeschooling

Teachers choosing the details of their employment, such as the grade levels and subjects

Principals and superintendents working together to choose the locations and appearance of school buildings

Students being given increasing responsibility for their own school-related choices as they rise in grade level

Answers

Answer:

A

Explanation:

Families choosing the type of schooling their children will receive, such as public, private, or homeschooling

Which natural element do Zoroastrians consider as Ahura Mazda’s symbol?
A. fire
B. air
C. water
D. earth

Answers

Zoroastrian prayers are to be said in the presence of light, either in the form of fire or the sun.
The answer is = Fire

To evaluate a program designed to improve math scores for elementary school girls, girls were divided into treatment and control groups. Girls in the treatment group were required to attend an after-school program, while girls in the control group went home on time. Math exam scores were then compared between the two groups of girls. This type of program design is associated with:

Answers

Answer:

Explanation:

To evaluate a program designed to improve math scores for elementary school girls, girls were divided into treatment and control groups. ... required to attend an after-school program, while the girls in the control group went home on time.

After the terrorist attacks of September 11, 2001, and the declaration of the War on Terror, America invaded

Answers

Answer:

Iraq and Afghanistan

Explanation:

Answer:

Afghanistan and Iraq.

Explanation:

Other Questions
A water pipe has a flow of 2 gallons per minute how many 2 qt could fill it in 1/2 hour? April ought some sports drinks and slices of pizza for her friends. She bought 3 more sports drinks than slices of pizza. If her total was $21.25, how many sports drinks did she purchase? (1 sports drink is $1.75, one pizza slice is $2.75){System of Operations} La oracin que representa un smil es: A. . Cerca del Tajo, en soledad amena, B. . Si no regresas pronto a mi lado, morir desangrado C. Los invisibles tomos del aire D. Eres como el viento tibio de los arenale What river connects the Great Lakes to the Atlantic Ocean? Alyssa's mother was sick. Alyssa, went to the store and bought 2/10 pound of medicine, then another 1/10 of medicine. What would the answer be when you add them together? Denominator stays the same. Jeremiah spent $68 for concert tickets. He bought one adult ticket for $18 and several children's tickets for $10 each. Which number line represents the number of children's tickets Jeremiah bought? Someone suggested that everything to be sent to the base on the moon must be sterelized so that no bacteria of any kind are present.Do you think this is a good idea Halfway through the third quarter, how much of the game is left?Write the answer as a proper fraction, View the work of art and answer the questions below.The work above is typically known by the name of its location. What is the name of the structure where the work be found? Who created it? PLEASE HELP WILL GIVE BRAINLIEST!! Please please only answer if you know or can help!! I need help know if what i already put is correct or how i can fix it and also the answer to question E. THANK YOU! When McCandless is working for Wayne Westerberg in Carthage, South Dakota, Westerberg thinks that McCandlessA.is lazyB.is addicted to drugsC.is probably mentally illD.is one of the hardest workers he has ever seenE.is a genius and an artist What is correct regarding trans fatty acids Choose two or three of the characteristics of successful organizations discussed in this article that you feel are the most important and, using specific examples, explain why you feel that way. (Site 1) hi can you please help me with my work Add the two functions. f(x) = 3x3 + 7x 26 g(x) = x + 2 Please help! Thank you! HELP mE need math help 20 points no links or imma report HeLP mE Find the area of the white region in the diagram shown. The sum of three consecutive integers is -27 what is the product of the smallest and largest of the three integers? what is the mRNA in TACCGGATGCCAGATCAAATC?