hi besties help me

Answers

Answer 1

Same I also need help ;-;

Answer 2
Same I need help :/.

Related Questions

HELPPPPP
Directions: Find the slope of the lines graphed below.
1.
2.
3.
4.
5.
6.
Directions: Find the slope between the given two points.
7.(-1,-11) and (-6, -7)
8. (-7.-13) and (1, -5)
9. (8.3) and (-5,3)
10. (15, 7) and (3,-2)
11. (-5, -1) and (-5, -10)
12. (-12, 16) and (-4,-2)
Directions: Use slope to determine if lines PQ and RS are parallel, perpendicular, or neither.
13.P(-9,-4), (-7, -1), R(-2,5), S(-6, -1)
m(PO)
m(RS)
Types of Lines
PLEASE HELLPPPP

Answers

Answer:

7. -4/5

8. 1

9. 0

10. 3/4

11. undefined/nonlinear

12. -9/4

13. parallel

2. Two points are shown on the coordinate plane. How any units apart are
Point A and Point B?*

Answers

Answer:

Step-by-step explanation:

The point p=(x,1/2)
Lies in the unit circle shown below what is the value of X in simplest

Answers

Hahaha give me these points is p=1/2

A soccer ball has an interior
diameter of 22cm. How
many cubic centimeters of air
does a soccer ball contain,
rounded to the nearest
hundredth?

Answers

Answer:

5575 cm³

Step-by-step explanation:

The volume of a sphere is V = (4/3)πr³.  If we substitute r = (d/2 where r is the radius and d the diameter), this formula becomes:

                                        πd³

V = (4/3)π·d³/8, or V = -------------

                                           6

and so, if d = 22 cm, the volume is:

        π(22 cm)³

V = ------------------- = 5575 cm³

              6

555555555555 plzzz help

Answers

Answer: C

Because BD would be longer than AC

6р + 22 – 10
Help me please

Answers

Answer:

P = -2

Step-by-step explanation:

6p +22 =10

     -22    -22

6p= -12

6       6

p=  -2

Im pretty sure thats it.

The width of a rectangle is 4 feet and the diagonal length of he rectangle is 13 feet what is the measurement is the closest to the length of the rectangle in feet

Answers

Answer:

The length is APPROXIMATELY equal to 12.4.

Step-by-step explanation:

Use the converse of the Pythagorean Theorem ([tex]a^{2}[/tex]+[tex]b^{2}[/tex]=[tex]c^{2}[/tex] [where "c" is both the longest side and the hypotenuse]) since a rectangle's diagonals will always cut it into two right triangles:

[tex]13^{2} = 169[/tex]

[tex]4^{2} =16[/tex]

169-16=153.

[tex]\sqrt{153}[/tex] ≈ 12

or

[tex]\sqrt{153}=12.36931688[/tex]

or if the problem has to be exact (using radicals)

3*[tex]\sqrt{17}[/tex]

I hope this helps ;)

E B A G ord Теа F NOTE: Angles not necessarily drawn to scale.
help ​

Answers

Answer: x = 13

angel bge and angle agf are vertical meaning they’re equivalent

77 + 90 + x = 180 (180 because all of them added together are supplementary)

167 + x = 180

x = 13

Answer:

Step-by-step explanation:

X=13

question number 7 and 8 only.​

Answers

Don’t click the link!!

please please please help​

Answers

Answer:

I wanna say 16 but im not sure

Step-by-step explanation:

factor this trinomial in standard form 2n^2 + 7n + 5

Answers

Answer:

Observation : No two such factors can be found !! Conclusion : Trinomial can not be factored. Equation at the end of step 2 : 2n2 - 7n - 5 = 0. Step 3 : Parabola ...

Step-by-step explanation:

if h(x) = 3(x + 6), find h(-1).
a.3
b.9
c.15
d.21​

Answers

It will be 15 I Believe

ILL MARK BRAINLIESTTTTT

Answers

Answer:

0.075 inches per year

Step-by-step explanation:

The average rate of change is measured as

( difference in diameter ) ÷ ( difference in years )

= ( 251 - 248 ) ÷ ( 2005 - 1965 )

= 3 inches ÷ 40 years

= 0.075 inches per year

Which of the following describes the square root of 41. 5,6 6,7 20,21 40,42

Answers

Answer:

6,7

Step-by-step explanation:

the squre root of 41 is 6.403

Please help :) thank you to whoever does help!?

Answers

Answer:[tex]\boxed{\boxed{\sf{a=5}}}[/tex]Solution Steps:

____________________________

1.) Fill in the formula: F = [tex]B^2-C^2=A^2[/tex]F = [tex]12^2-13^2=A^2[/tex]F = [tex]144-169=A^2[/tex]

2.) Subtract:[tex]169-144=25[/tex]

3.) Find the square root of 25:[tex]\sqrt{25} =5[/tex]

So your answer would be C, [tex]\bold{a=5}[/tex].

____________________________

If x=(y+2)^2 and y= -7 then what is x

Answers

Answer:

X=25

Step-by-step explanation:

y+2=-7+2=5

[tex]5^{2} =25[/tex]

The answer should be x=25

A hiker is lost in the forest, but has his cell phone with a weak signal. Cell phones with GPS can give an approximate location through triangulation, which works by giving distances from two known points. Suppose the hiker is within distance of two cell phone towers that are 22.5 miles apart along a straight highway (running east to west, double-dashed line). Based on the signal delay, it can be determined that the signal from the hiker's phone is 14.2 miles from Tower A and 10.9 miles from Tower B. Assume the hiker is traveling a straight path south reach the highway quickly. How far must the hiker travel to reach the highway

Answers

Answer:

The distance the hiker must travel is approximately 5.5 miles

Step-by-step explanation:

The distance between the two cell phone towers = 22.5 miles

The distance between the hiker's phone and Tower A = 14.2 miles

The distance between the hiker's phone and Tower B = 10.9 miles

The direction of the highway along which the towers are located = East to west

The direction in which the hiker is travelling to reach the highway quickly = South

By cosine rule, we have;

a² = b² + c² - 2·b·c·cos(A)

Let 'a', 'b', and 'c', represent the sides of the triangle formed by the imaginary line between the two towers, the hiker's phone and Tower A, and the hiker's hone and tower B respectively, we have;

a = 22.5 miles

b = 14.2 miles

c = 10.9 miles

Therefore, we have;

22.5² = 14.2² + 10.9² - 2 × 14.2 × 10.9 × cos(A)

cos(A) = (22.5² - (14.2² + 10.9²))/( - 2 × 14.2 × 10.9) ≈ -0.6

∠A = arccos(-0.6) ≈ 126.9°

By sine rule, we have;

a/(sin(A)) = b/(sin(B)) = c/(sin(C))

∴ sin(B) = b × sin(A)/a

∴ sin(B) = 14.2×(sin(126.9°))/22.5

∠B = arcsine(14.2×(sin(126.9°))/22.5) ≈ 30.31°

∠C = 180° - (126.9° - 30.31°) = 22.79° See No Evil

The distance the hiker must travel, d = c × sin(B)

∴ d = 10.9 × sin(30.31°) ≈ 5.5

Therefore, the distance the hiker must travel, d ≈ 5.5 miles.


[tex]8 \times \frac{3}{4} [/tex]

Answers

Answer:

6

Step by step explanation:

8 × ¾ = ²⁴⁄₄ = 6

Answer:

6

Step-by-step explanation:

You can solve this equation in multiple ways:

1) Change [tex]\frac{3}{4}[/tex] into a decimal

[tex]\frac{3}{4} = .75[/tex][tex]8[/tex] × [tex].75 = 6[/tex]

2) Change [tex]8[/tex] into a fraction, and multiply that way.

[tex]8 = \frac{8}{1}[/tex][tex]\frac{8}{1}[/tex] × [tex]\frac{3}{4} = \frac{24}{4}[/tex][tex]\frac{24}{4} = 6[/tex]

A custom fish tank shaped like a rectangular prism needs to have a length of 21 inches, a width of 16 inches and hold a volume of 6758 cubic inches. What height must the tank be made to meet these specifications?

Answers

Answer:

i dont know im not that smart ask someone else dude

Step-by-step explanation:

Express as a trinomial.
(x – 3)(3x – 8)
Please do this ASAP i need HELP

Answers

Answer:

3x^2 - 17x + 24

Step-by-step explanation:

(x – 3)(3x – 8)

3x^2 + (-8x) + (-9x) + 24

3x^2 - 17x + 24

the length of an arc of a circle is 1/5 of its circumference. if the area of the circle is346.5cm²,find the angle subtended by the arc at the centre of the angle​

Answers

Answer:

72°

Step-by-step explanation:

From the question,

Area of the circle = πr²

A = πr²................. Equation 1

Where r = radius of the circle.

⇒ r = √(A/π)............. Equation 2

Given: A = 346.5 cm², π = 3.14

r = √(346.5/3.14)

r = √(110.35)

r = 10.5 cm.

Therefore,

circumference of the circle = 2πr = 2×3.14×10.5

circumference = 65.94 m

If the length of the arc(s) is 1/5 of its circumference.

Therefore, length of arc (s) = 13.188

⇒ length of arc/circumference = 13.188/65.94 =  1/5

s/2πr = θ/360

Where θ = angle substends at the center of the circle

1/5 = θ/360

θ = 360/5

θ = 72°

⚠️⚠️⚠️⚠️⚠️help⚠️⚠️⚠️⚠️⚠️​

Answers

Answer:

u have it right it increases by 1:75 per time

Step-by-step explanation:

Answer:

A

Step-by-step explanation:

it is A because it is increasing by 1.75 each week

44% of what number is 400?

Answers

Answer:

909.09

Step-by-step explanation:

400 divided by 44% is about 909.09.

909 !!!!!!!!!!!!!!!!!!!!!

Martin recorded the low temperatures at his house for one week. the temperatures are shown below -
-7, -3, 4, 1, -2, -8. 7
Approximately what was the average low temperature of the week?

Answers

Answer:

The average temp was 4

Step-by-step explanation:

A certain county is 25​% African American. Suppose a researcher is looking at jury​ pools, each with 200 ​members, in this county. The null hypothesis is that the probability of an African American being selected into the jury pool is 25​%. a. How many African Americans would the researcher expect on a jury pool of 200 people if the null hypothesis is​ true? b. Suppose pool A contains 17 African American people out of 200​, and pool B contains 39 African American people out of 200. Which will have a smaller​ p-value and​ why?

Answers

Answer: a. 50 African Americans

b. Pool B will have a smaller​ p-value because that pool's number of AA people is further from the hypothesized number of AA people.

Step-by-step explanation:

Morgan purchased $30.46 worth of groceries. She paid the cashier with
a $50 bill. How much change should she receive?

marking brainliest
if right
+
how to get

Answers

Answer: 19.54

explanation:

50.00

-

30.46

----------------

19.54

Answer: 19.54$

Step-by-step explanation: 50.00

                                            -30.46

                                            = 19.54

XA ) -
Calculate the volume of the prism by first finding the total number of half-unit
cubes that will fill it. There are 8 half-unit cubes in every unit cube.
23
A. Number of half-unit cubes = 10
V = 2 cubic units
B. Number of half-unit cubes = 20
V=2 cubic units
O C. Number of half-unit cubes = 20
V = 10 cubic units
D. Number of half-unit cubes = 10
V = 5 cubic units

Answers

Answer:

Option B will be your answer

Step-by-step explanation:

V=2 1/2×1/2×2

=2.5 cube

volume of 1/2 cubic units =)(1/2×1/2×1/2=0.125cube^3

2.5/0.125=20

Hope it helps...

your answer is option B

v = 2½

number of half unit cubes = 20

Which expression is equivalent to 21x + 9 - 3x? A. 9(2x - 1) B. 9(x + 1) C. 9(2x + 1) D. 18(x + 1) ​

Answers

Answer: C

Step-by-step explanation:

21x+9-3x = 18x + 9

If you factor out the 9, you would be left with

9 (2x+1)

Answer: A. 9(2x - 1)

Step-by-step explanation:

combine like terms

21x+9-3x

21x-3x

18x+9

Factor the expression

factor out 9 from the expression

you get 9(2x - 1)

Finish the table using
the equation.


Anyone help please ! ?

Answers

Answer:

y = 0.5,  1,  1.5,  2

Step-by-step explanation:

x is twice as much as y, so when you multiply the input for y by 2, it should get the value of x. Example: if y is 1, then x is 2, because 1*2 = 2

hope this helped!

Find the area of this kite.
3 m
5 m
6 m
5 m

Answers

Answer:

450m

Step-by-step explanation:

Other Questions
Please Answer! I will give brainiest. The Picture is down below :)Thank You! EXERCISE 1 IMAGINE YOU ARE A CHILD AT SCHOOL .WRITE A DIARY ENTRY IN ABOUT 150-200 WORDS ABOUT YOUR EMOTIONS THE DAY BEFORE YOUR SCHOOL TAKES YOU TO A THEME PARK Please answer these questions and I swear I will give you brainlist I promise I will answer this question part a and part b please What is the length of the missing leg?45 and 36 Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) What is Isolated system How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air I have to find the missing angles In what Century did people learn how traits pass from one living being to itsdescendants? Find the sum or typeimpossible"Help Resources[1 -2 1] + [4 -5 -6]Skip[[?]Enter Texas Roadhouse opened a new restaurant in October. During its first three months of operation, the restaurant sold gift cards in various amounts totaling $1,800. The cards are redeemable for meals within one year of the purchase date. Gift cards totaling $728 were presented for redemption during the first three months of operation prior to year-end on December 31. The sales tax rate on restaurant sales is 4%, assessed at the time meals (not gift cards) are purchased. Texas Roadhouse will remit sales taxes in January.Required:a. Record (in summary form) the S3,500 in gift cards sold (keeping in mind that, in actuality, the firm would record each sale of a gift card individually). b. Record the S728 in gift cards redeemed. c. Determine the balance in the Deferred Revenue account (remaining liability for gift cards). HEY CAN SOMEONE HELP ME WITH MY LASTEST MATH QUESTION I WILL GIVE BRAINLIST PLEASE :))) The owner of Chips etc. produces two kinds of chips: lime (L) and vinegar (V). He has a limited amount of the three ingredients used to produce these chips available for his next production run: 4800 ounces of salt, 9600 ounces of flour, and 2000 ounces of herbs. A bag of lime chips requires 2 ounces of salt, 6 ounces of flour, and 1 ounce of herbs to produce; while a bag of vinegar chips requires 3 ounces of salt, 8 ounces of flour, and 2 ounces of herbs. Profits for a bag of lime chips are $0.40, and for a bag of vinegar chips $0.50. Match the western nations to their coloniesUnited StatesFranceGreat BritainThe Netherlands