Decided to draw my pic crew avatar, thoughts?

Decided To Draw My Pic Crew Avatar, Thoughts?

Answers

Answer 1

Answer:

LOVE IT XD

ur really good never give up on something u like

Answer 2

Answer:

Woah your a great artist

Explanation:

The hands a bit wonky, love it thooo


Related Questions

If Alan Walker is 23, and Marshmello is 28, then why is Marshmello still not as good as Alan?

Answers

Answer:

Thats called an opinion

Explanation:

I like Marshmello way better

Answer:

I actually like Alan Walker better. But another masked Dj that i like best is Deadmau5. Deadmau5 is so good.

Mention 4 reasons why is it important to apply for entry at tertiary institutions while you are in grade 11

Answers

Answer:

Take advantage of the spaces reserved for this type of registration.Have more time and peace of mind to register.To be independent of the Matric resultsPresent commitment and organization to universities.

Explanation:

A characteristic much appreciated by universities is the commitment and organization of students to academic life. When the student enrolls for the university in the 11th grade, he/she presents these characteristics, as it shows that he is organized early for university life, showing a strong dedication to his future as a student and professional. In addition, in the 11th grade, the student can enjoy more tranquility to make the registration, as he/she has time to repeat it in the next years, if necessary.

Another advantage of enrolling for universities in the 11th grade is the ability to be independent of Matric results, since universities can assess the student's academic results based on their grades in the 11th grade. Last, but not least, the student can take advantage of the places reserved by the university, as these places are limited.

All official post-secondary education, including private and public universities, technical training institutes, colleges, and vocational schools, is referred to as tertiary education.

What are the reasons to apply to tertiary institutions?

Utilize the spaces set for this type of registration.Allow yourself extra time and peace of mind when registering.to be unaffected by Matric results.Universities' current dedication and organization.

In general, tertiary applications filed through TAC websites for admittance into higher education courses are referred to as "course preferences."

Students can apply for many courses at the same time by submitting preferences instead of submitting separate applications to each institution.

Because you must work in order for your family to survive and for you to be able to go in peace and happiness. That is why applying for an admission is crucial. This is what you must do.

Choose a course that you qualify for based on your entrance scores and the institution's prerequisites. Check with the Department of Education to see if a private institution is registered.

Directly apply to the school of your choice for admission. Fill out the application form that the institution has provided you with.

For more information about tertiary institutions, refer below

https://brainly.com/question/992857

Read the passage from a short story.

She was a dreamer, my grandmother. A tiny little person with big ideas. She was always ready to share her ideas with the world. When people looked at her, they never saw her gray hair or wrinkled skin. Instead, they saw her life, her spirit, and her dreams.

A photograph of the author’s grandmother would help bring out which part of the passage?
A. "She was a dreamer, my grandmother."
B. "Instead, they saw her life, her spirit, and her dreams."
C. "She was always ready to share her ideas with the world."
D. "When people looked at her, they never saw her gray hair or wrinkled skin."

Answers

D. Because you know she‘s a grandma, you don’t need a picture to show her knowing she was ready to share her ideas, and you also know that she’ just too wise for people to notice her hair and skin.

Answer:

d

Explanation:

can ya guesss??



"...I tried to scream
But my head was underwater
They called me weak
Like I'm not just somebody's daughter
Could've been a nightmare
But it felt like they were right there
And it feels like yesterday was a year ago
But I don't wanna let anybody know
'Cause everybody wants something from me now
And I don't wanna let 'em down.."
I LUV THIS SONG

Answers

Answer:

Everything I wanted.

Explanation:

Song is by Billie Eilish.

Answer:

everything i wanted

Explanation:

billie eilish

Which of these sentences would make a good direct quote? Dendrochronology is the study of "tree time" and is also called tree-ring dating. Cross-dating is a method used to match tree-ring patterns in different trees. A dendrochronologist is a scientist who uses the natural clues found in tree rings.

Answers

Answer:

a tree ring because of these " mean that it is a quote

Explanation:

Answer: Dendrochronology is the study of "tree time" and is also called tree-ring dating.

Explanation: This is the most logical answer, because it would work best as a direct quote. Also, I've done the same quiz!

who is NBA yougboy ===

Answers

Answer:

a rapper is who he is

Explanation:

He is an Rapper

Hope this helps!

In Ecuador, ________________ control most of the wealth.
a.
natives
c.
Europeans
b.
mestizos
d.
foreign banks

Answers

Answer:

the answer is c. Europeans

Explanation:

please give brainliest!!!!!

Answer:

c. Europeans

explanation: they tended to want to expand their colony

How have the social media helped in making each art from more popular at present than in previous decades

Answers

Answer:

Social media helped to expose different art forms to more people

I just wanna pay my bills
Rappin bout the way I feel
I just wanna make a couple mill
Leave it to the fam in the will
I just wanna sign a record deal
Maybe buy a house up in the hills
Might not be the best in my field
But I guarantee that ima die real

Honestly just wow

Answers

Answer:

NF - When I Grow Up

Explanation:

Love that song!

What do you think your first job is going to be?

Me, I honestly want my first job to be a Cold Slab place

Answers

Answer:

My fist job is going to be helping at a library.

Explanation:

Who is opposed to Carole going into Manhattan to try to sell song? A. Her mother B. Her father C. Her friend D. Her husband

Answers

Answer:

They were parents and retirees, police officers and doctors, imperfect but loved deeply.

After her husband died, she settled in St. Petersburg, where the family had  After his death March 27, friends described him as “a pioneer among LGBT  Even though he disliked strawberries, he'd go get strawberry

Explanation:

Look at this painting by Francisco Zurbaran. Which technique is
demonstrated?
A. Worm's-eye view
B. Distortion
C. Sfumato
D. Tenebroso

Answers

Answer:

D  TENEBROSO

Explanation:

HELP ME??? WILL MARK BRAINLESIT

I KEEP SEEING 12:12 IT IS FREAKING ME OUT SO BAD

WHAT DOES THIS MEAN?

Answers

Answer: Angel number 1212 symbolizes your spiritual growth and awakening, manifestation of your dreams, and awareness of your infinite being. You should continue to remain positive frame of mind and steer your thoughts in the direction of your dominant ambition. Another meaning of 1212, or seeing 12:12, is a reminder to be aware of your thoughts and keep a positive state of mind. As you infuse positivity into your thought patterns, you are ultimately creating more positive outcomes in your life, thus reaching your highest potential.

Explanation:

Don’t freak out...usually when u see specific number patterns constantly it has a meaning or at least that what I tend to believe. Like whenever I look at my clock it’s always 9:11 or when I go outside I’m seeing yellow butterfly’s everywhere and cardinals which have a spiritual significance if you believe in that’s stuff (personally I do) but if you don’t that’s fine too but just do some research about the numbers and see if the meaning has any connection to your life

will mark brainliest if correct

Which option best describes oil paints?

They are the most expensive type of paint. However, they do dry very quickly.
They are popular among master painters because of their mixing techniques and for creating layers to their work.
They are more vibrant and versatile and are less expensive than some other paints.
They are great paints for beginning artists and for those who want to be teachers some day.

Answers

ANSER:
They are popular among master painters because of their mixing techniques and for creating layers to their work.

I HOPE THIS HELPS!

They are popular among master painters because of their mixing techniques and for creating layers to their work.- best describes oil paints.

Because of their exceptional blending abilities and capacity to add layers of depth and texture to paintings, oil paints are highly prized by master painters. These paints are renowned for their richness and adaptability and provide a wide range of vibrant colors. Oil paints are a preferred option for artists looking for professional results despite being more expensive than some other paint types.

Due to the slow drying time, artists can work with the paint for extended periods of time giving them plenty of time to blend and create the desired effects. Even though they might not be the most affordable choice for aspiring artists, oil paints are a priceless tool for those who want to produce works of art of the highest caliber.

learn more about Oil paints here

brainly.com/question/32271637

#SPJ2

A student learns about the principles of design in her textbook and creates a work using each one exactly as it is described. What does her work lack?

objectivity

focus

creativity

detail

Answers

Um is there a picture?

Subject is art answer the question below :))

Answers

Answer:

persuasive ads still exist today and they've changed for the better by putting in more relatable and up-to-date reasons for you to buy the product.

Hope that helps :)

Explanation:

Answer:

yes bestie

Explanation:

some of you play among us :3

Answers

Most of us do ♥️
Especially the ones who clicked into this question

Answer:

I don't I play games on the PS4, PS3, and Wii

Explanation:

What is the definition of Impressionism?


A. a practice in painting where shapes, lines, and colors are abstracted.


B. a practice in painting where objects are painted realistically and they are not idealized.


C. a practice in painting of depicting the natural appearances of objects by means of dabs or strokes of primary unmixed colors in order to simulate actual reflected light


D. a practice in painting where colors and shapes are non representational.

Answers

Maybe it’s c and I hope it helps to you......

Read the following passage from a novel.

To say we were hot would be an understatement. When you are hot, you can sweat. This air was so dry, it felt as if the desert was pulling all the moisture out of our bodies. We looked out on the dry, barren desert and saw nothing but sand for miles.

An illustration of the desert would bring out the meaning of which phrase from the passage?
A. "To say we were hot would be an understatement."
B. "When you are hot, you can sweat."
C. "This air was so dry, it felt as if the desert was pulling all the moisture out of our bodies."
D. "We looked out on the dry, barren desert and saw nothing but sand for miles."

Answers

Answer:

to say we were hot would be an understatement

The concept of _______________ _________________ urges businesses to rethink their business models to include a higher purpose, stakeholder integration, conscious leadership, and conscious culture and management. Patagonia is an example of a company that has aligned itself with this concept, because "it is right to do what is right".

Answers

Answer:

Conscious capitalism (I think!)

Explanation:

The concept of Conscious capitalism urges businesses to rethink their business models to include a higher purpose, stakeholder integration, conscious leadership, and conscious culture and management. Patagonia is an example of a company that has aligned itself with this concept, because "it is right to do what is right".

Why do we need conscious capitalism?

Conscious capitalism arose as a result of necessity. Businesses must accept responsibility for their social impact, including how they treat their employees, customers, neighboring communities, stakeholders, the environment, and our world in general.

John Mackey and Raj Sisodia founded Conscious Capitalism, a socially responsible economic and political philosophy. Proponents think that organizations should conduct themselves ethically by serving the interests of all stakeholders, not only corporate management and shareholders.

Learn more about conscious capitalism here:

https://brainly.com/question/14464893

#SPJ2

Do you think understanding the culture and music of the Filipinos would help foreigners understand us better? Why? *

Answers

Answer:

Yes!

Explanation:

Understanding a culture and their music can help find better connections and understand Filipinos a lot more, it better helps foreigners get to know more about the backgrounds of their cultures and their ways of expressing through music.

Who kno this song

Shorty Be Mine
Song by Pretty Ricky

Answers

Answer:

[tex]um \: not \: me......is \: it \: good[/tex]

Answer:

Meeeee this song is so old.

Explanation:

Here is some lyrics:

Say shorty would you be mine  

Say would you be mine  

Shorty would you be mine

Which of the following is a characteristic of active listening?
A. Listen to a work once.
B. Know the names of many compositions.
C. Listen only to one style of music.
D. Listen to music for specific details and techniques.

Answers

Answer:

D. Listen to music for specific details and techniques.

Explanation:

haracteristic of active listening:

D. Listen to music for specific details and techniques.

The characteristic of active listening is to music for specific details and techniques. Thus, the correct answer is option (D).

What is active listening?

Active listening is the practice of getting ready to listen, observing what verbal and nonverbal messages are being sent, and then providing appropriate feedback to demonstrate attention to the message being presented. This type of listening communicates a mutual understanding between the speaker and the listener.

Speakers receive confirmation that their message is being received, and engaged listeners absorb more content and understanding. The overarching goal of active listening is to eliminate misunderstandings and to establish clear communication of thoughts and ideas between the speaker and the listener. Carl Rogers and Richard Farson pioneered active listening.

Therefore, listening to music for specific details and techniques is a characteristic of active listening.

To learn more about active listening, click here:

https://brainly.com/question/2513114

#SPJ6

3
Your classmate Juliette feels overwhelmed while trying to critique a piece of art. She conf
the best advice you have for Juliette to help her with her critique?
O A.
Start with a description of the piece.
B.
Start by evaluating the piece.
Start with an analysis of the piece.
C.
D.
Start by interpreting the piece.
Reset
Next

Answers

Answer:

D......................

The best advice you have for Juliette to help her with her critique is to Start by evaluating the piece. Option B is an appropriate response.

What are the steps of critiquing art?

You can analyze a piece of work more objectively if you are aware of the processes in the art criticism process. The practice of art criticism include describing and evaluating artistic creations.

Evaluating the relevance, worth, and meaning of art will help you gain a deeper understanding of the arts, and you'll also be able to support the artist as they develop their own artistic style.

An art critique starts with an evaluating of the piece. Critiques of art are of no use to someone trying to improve their own work. You are not allowed to review your own artwork. The same format and questions must be used in all art reviews.

Hence, Option B is an appropriate response.

To learn more about art critique

https://brainly.com/question/9493278

#SPJ5

How was the Neolithic period different from the Paleolithic period?

A. People moved from a nomadic life to a stable life as villagers and farmers.

B. People started building shelters from hides and branches.

C. People started making different kinds of tools, such as hand axes, to make sculptures.

Answers

Answer:

The Neolithic Period marked a shift from a nomadic lifestyle to a sedentary one, and people began to build shelters and stick around in one area, rather than just living in natural shelters. People were already making tools during the Paleolithic Era.

Explanation:

who like gachas (pls dont report just want to make friends)if you do what kind i like the your not my alpha series. if you dont know what that is you should watch the videos

Answers

Answer:

I watch a lot of Mha tik.tok reaction videos and Jade Spade

Explanation:

Answer:

i luv gacha club

HELP!!!!

Identify and discuss five Greek and four Roman cultural contributions that still influence us today. Please answer with a paragraph.

Answers

Answer:

the culture of Greek was evolved over thousands of years, and is wisely considered to be the cadle of modern western culture. this is because political systems and procedures such as democracy, trial by jury and lawful equality originated there

aside form these important Greek- derived features of Western civilization, ancient Greacian thinkers and architects laid the intellectual foundations of many fields of study. whether it be astrology, mathematics, biology, engineering, medicine or linguistics ancient Greeks

As if all of this wasn't enough when it comes to the realm of art - including literature, music, architecture, design and the performing arts- the Greeks established many of the standards by which identify beauty and creative value

Why did Picasso paint Guernica?

A)The Spanish government wanted to remember the event.

B)The have a mural with a war theme.

Answers

Answer:

B

Explanation:

Picasso painted Guernica at his home in Paris in response to the bombing of Guernica, a Basque Country town in northern Spain, by Nazi Germany and Fascist Italy at the request of the Spanish Nationalists. ... The touring exhibition was used to raise funds for Spanish war relief.

Two wedge symbols point to the right. One wedge symbol points down. Two small wedge symbols point to the right and slightly down. In 700 BCE, this symbol in represented ___________ in cuneiform. a. horse c. goddess b. river d. bull

Answers

Answer:

ITS D!!!!!!!!!!!!!!!!!!!!!

Explanation:

Answer:

its D

Explanation:

its D

Warm-up:

What is your favorite memory and why? Give me five of them

Explain.

Answers

Answer:

#1 when me and my best friend were sitting and listening to the radieo commedians "i wish i would have made the first move but"

#2 when im alone in bed just liein there thinging abt good old times "its real fun try it"

#3 BEING ALONE LOL

#4 my first kiss "i was 9 oops" but yea he made the first kiss yup yup yup

#5 id.k lol

Explanation:

Other Questions
Michael bought three baseballs from a sports store. Each baseball cost the same amount. The total cost was $8.37. If C represents the cost of each baseball, which of the following statements are true? Select all that applyThe value of c can be found using the formula 30+837The value of c can be found using the formula C/8.37 = 3Each baseball cost $25.11Each boseball cost $279 Need help ASAP giving away 15 points will mark brainlyist as well A phase change is when a substance changes from one state of mind to nother because of the adding or removal of thermal energyTrueFalse pleaase help withhh tthis Please Answer! I will give brainiest. The Picture is down below :)Thank You! EXERCISE 1 IMAGINE YOU ARE A CHILD AT SCHOOL .WRITE A DIARY ENTRY IN ABOUT 150-200 WORDS ABOUT YOUR EMOTIONS THE DAY BEFORE YOUR SCHOOL TAKES YOU TO A THEME PARK Please answer these questions and I swear I will give you brainlist I promise I will answer this question part a and part b please What is the length of the missing leg?45 and 36 Which statement best describes a difference between a molecule of DNA and a molecule of RNA? A)DNA contains genetic informationwhile RNA does not B)RNA contains the letter in place of the letter T in DNA C)DNA has 1 strand, while RNA has 2 D)RNA uses the letter C. while DNA does not NEED HELP WITH THESE f(x)=x^2-x+1g(x) = 5 - 3xEvaluate the following.1) f(-1)2)g( -8)3)f( 1)4) g(5)5) f(3)6) g(-3) How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air I have to find the missing angles In what Century did people learn how traits pass from one living being to itsdescendants? Texas Roadhouse opened a new restaurant in October. During its first three months of operation, the restaurant sold gift cards in various amounts totaling $1,800. The cards are redeemable for meals within one year of the purchase date. Gift cards totaling $728 were presented for redemption during the first three months of operation prior to year-end on December 31. The sales tax rate on restaurant sales is 4%, assessed at the time meals (not gift cards) are purchased. Texas Roadhouse will remit sales taxes in January.Required:a. Record (in summary form) the S3,500 in gift cards sold (keeping in mind that, in actuality, the firm would record each sale of a gift card individually). b. Record the S728 in gift cards redeemed. c. Determine the balance in the Deferred Revenue account (remaining liability for gift cards). HEY CAN SOMEONE HELP ME WITH MY LASTEST MATH QUESTION I WILL GIVE BRAINLIST PLEASE :)))