¿¡ Cuanto es "(8 x 7 + 5 x (-8)) : (-4)" ??

Answers

Answer 1

Answer:

-4

Step-by-step explanation:

So like ur last problem do it in order left to right.

[8x7]+5x(-8)/(-4)

56+[5x(-8)/-4

56+(-40)/-4

16/-4=(-4)

Sorry if i did in wrong order.

Answer 2
Answer: 4(14x-11) hop that can help you

Related Questions

A debt payment of $5,500 is due in 27 months. If money is
worth 8.4% p.a. compounded quarterly, what is the equivalent
payment? Now? 15 months? 27 months? 36 months?

Answers

Step-by-step explanation:

A=P(1+0.084) ^n;

=5500(1

The payment now is $4561.7450, 15 months later $5061.28, 27 months later $5500.00595 and 36 months later $5853.83.

Interest rate = 8.4/4 =2.1% = 0.021 every 3 months

The debt of $5500 is due in 27 months.

What is the formula to find compound interest?

The formula to find the compound interest is  [tex]FV=PV(1+r)^{n}[/tex].

Now, [tex]PV=FV(1+r)^{-n}[/tex].

The payment now:

5500*(1.021)^-9 = $4561.7450

So if $5500 is due in 27 months its current value is $4561.7450.

( b) 15 months from now? 5 quarters  

FV(15months)= 4561.75*1.021^5

4561.75*1.021^5 = $5061.28

(c) 27 months from now? 9 quarters

FV(15 months)= $5500  that was given in the question

Verification:

FV(27months)=4561.75*1.021^9

4561.75*1.021^9 = $5500.00595

(d) 36 months from now?   12 quarters

FV(36months)=4561.75*1.021^12

4561.75*1.021^12 = $5853.83

Therefore, the payment now is $4561.7450, 15 months later $5061.28, 27 months later $5500.00595 and 36 months later $5853.83.

To learn more about compound interest visit:

https://brainly.com/question/14295570.

#SPJ2

please help confused tyy​

Answers

d=9

You want to set the angles equal to 90°
So it would look like this

(6d+8)+(3x+1)=90

then you would solve

Hope this helps ;)
Answer: d=9

(3d+1)+(6d+8)=90
3d+1+6d+8=90
9d+9=90
-9 -9
9d=81
divide by 9 on both sides
d=9

Explanation: In order to solve for d, you will need to remove the parentheses, then combine like variables. Then, subtract 9 from both sides. Finally, divide by 9 on both sides. You should get d=9.

Find the mid point of the line segment AB where A= (-5,5) and B= (-7,4)*

Answers

Check out the screenshot.

help me pls pls pls pls pls pls

Answers

10 is -35
11 is -30
12 is 1
And I don’t know 9 sorry

How was y'all day. I hope it is good

Answers

Answer:

My day has been going great! And I hope your day is going great too! :)

Step-by-step explanation: You are a perfect human :>

14. Evaluate the expression.
4!
24
28
20

Answers

Answer:

24.

Step-by-step explanation:

By definition,  factorial 4

= 4!

= 4*3*2*1

= 24.

the answer is 24!!!
it just is!

Will rank the correct answer brainliest!

Answers

Answer:

Step-by-step explanation:

diameter=2*radius

=2*9

=18 in

given central angle=72 degree

arc length=central angle /360° *πd

=72/360 *3.14*18

=1/5 *56.52

=56.52/5

=11.304

Answer:

arc length=2πr×0.2

=2×3.14×9×0.2

=11.304 inch²

the angle of elevation of the top of an elevator pole to a man standing 10m from it is 60°. find the height of the pole

Answers

Answer:

10√3m

Step-by-step explanation:

Given :-

Angle of elevation = 60° Distance between man and pole = 60°

We need to find the height of the pole . We are given here base. Therefore using ratio of tan ,

=> tan 60° = p/b

=> √3 = h / 10 m

=> h = 10 m× √3

=> h = 103 m

Name the kind or kinds of symmetry the following figure has: point, line, plane, or none. (o)

Answers

Mark Brainliest please

Answer is Line

Train A leaves Paris and travels at a constant speed of 75 mph toward Pisa. At the
same time. Train B leaves Pisa headed toward Paris at a constant speed of 50
mph. Let x represent time traveled in hours and let y represent miles from Paris. If
Paris and Pisa are 500 miles apart, when will the two trains pass each other?

Answers

Answer: [tex]4.016\ hr[/tex]

Step-by-step explanation:

Given

Train A has speed of [tex]v_a=75\ mph[/tex]

Train B has speed of [tex]v_b=50\ mph[/tex]

If Paris and Pisa is 500 miles apart

If they meet x hours after the start

The sum of the distances traveled by Train A and B is 500 miles

[tex]\Rightarrow 75\times x+50\times x=500\\\Rightarrow 125x=500\\\Rightarrow x=4.016\ hr[/tex]

So, after [tex]4.016\ hr[/tex] they will pass each other.

Which linear inequality is represented by the graph?
A.y<2/3x+3
B.y>3/2x+3
C. y>2/3 x + 3
D.y<3/2x + 3

Answers

The answer is C I did the test on Edge

Joan is buying airline tickets for her family. Each airline ticket costs $232 with a baggage fee of $13. The airline
charges a booking fee of $45 for the entire set of tickets. Joan spent a total of $1,515. If x represents the number of
tickets, which equation can be used to find the value of x?
O 245+45x = 1,515
O 232x+45x - 1,515
O 232x+45= 1,515
452455

Answers

Answer:

232x + 45 = 1,515

Step-by-step explanation:

45 is a one time fee for book several tickets at one. 232 is the cost of each ticket and 232 get x because we dont know how many family members Joan bought tickets for.

Nick has an album that holds 800 coins each page of the album holds eight coins is 82% of the album is empty how many pages are filled with coins

Answers

Answer:

18 Pages are filled with photos because you do 800÷8 and you get 100 coins then since it says 82% of the album is empty since the album has 100 coins it makes it easy and you subtract 82 from 100 therefore you get 18 coins that are filled

Step-by-step explanation:

Because you do 800÷8 and you get 100 coins then since it says 82% of the album is empty since the album has 100 coins it makes it easy and you subtract 82 from 100 therefore you get 18 coins that are filled

Where are the corresponding angles in the diagram below?
ANSWERS:

Answer #1: 1 and 5

Answer #2: 1 and 3

Answer #3: 2 and 4

Answer #4: 2 and 7

Answers

Answer #1 is the correct answer

Answer:

the answer is #1

Step-by-step explanation:

14cm and 31cm and 34cm equal

Answers

Answer:

if its addition then it will be 79cm

Solve for x.

•none of these
•21.8
•68.2
•66.42
Please helppp

Answers

Answer:

21.8

Step-by-step explanation:

5m is adjacent and 3m is opposite so you use the formula

tan theta=opposite/adjacent

can someone help me match these too?

Answers

ANSWER:

A is number 3

B is number 2

Step-by-step explanation:

The left side is A and B (order)

the right side is 1,2,3,4 (order)

explanation: A is number 3 because as said in A the tram already has 5 people which is what we start with a1 = 5 and we add 11 at each stop as shown in the equation.

B is number 2 for the same reason as it started with 2 but added 4 inches of rain each time.

What is parallel to y=-5+4.2x

Answers

Any line that has the same slope as the given equation , 4.2

Libby wants to buy 290 raspberry yogurts. They are sold in packs of 4. How many packs does she need to buy?

Answers

Answer:

73 packs

Step-by-step explanation:

Find how many packs she has to buy by dividing 290 by 4, since each pack has 4 yogurts.

290/4

= 72.5

Since we need a whole number answer, round this up:

72.5

= 73

So, Libby will need to buy 73 packs

- Javid bought 3 pairs of Nike Jordan True Flight sneakers
for $127.59 each. He sold 2 pairs of the shoes at a 28%
markup and the third pair for a 52% increase. What did
he sell each pair of shoes for?

- Harris wanted to purchase a pair of Reebok Liquid Speed sneakers for
$190. The price of the sneakers decreased 10% in value each of the next 2 weeks. Harris said that the shoes were 20% less than their original value after 2
weeks. Is Harris correct?

Please help me with these two. I will mark you as brainly

Answers

I’m not surevhcxjjbvcvhhccc

Help, please. I really need help one this

Answers

Answer:

2#) 20f+15-2f

18f+15

2#) choose 1

3#)60-3h-9

51-3h —> 3(17-h)

3#)choose 1

4#) 4(5x+3y)

20x+12y

4#)choose 4

5#) r+3r+ _=6r

6r-4r= 2r

5#)choose 4

Only point (1 ) I didn't know I'm sorry

simplify an expression
(x^2y^4z)^5/(xy)^2
A) y10z5
B) x6y7z5
C) x7y9z5
D) x8y18z5

Answers

Answer:

d

Step-by-step explanation:

A storage tank has a radius of x + 5 metres and a height of x metres. Determine the dimensions of the tank if the volume is 192π m 3 . Round your answers to two decimal places.

Answers

Answer:

that is the procedure above

In the year 2006, a person bought a new car for $18000. For each consecutive year after that, the value of the car depreciated by 15%. How much would the car be worth in the year 2009, to the nearest hundred dollars?



Please i need answer now

Answers

Answer:

Step-by-step explanation:

Use the exponential function

[tex]v(t)=a(b)^t[/tex] where a is the initial value of the car, b is the rate of decay, and t is the time in years. For us, a = 18000, b = (1 - .15), so the model for this car is:

[tex]v(t)=18000(.85)^t[/tex]  We can use this model now to find the value, v(t), of the car after 3 years has gone by (from 2006 to 2009 is 3 years):

[tex]v(t)=18000(.85)^3[/tex] and simplifying a bit:

v(t) = 18000(.614125) so

v(t) = 11054.25

Round however you need to.

I posted it nobody answer to it so *Help me*

Answers

Answer:

i think its 2

Step-by-step explanation:

I think it maybe 26

D) Sum of the two adjacent angles is 140°. If the second angle is 7 less than six times the first angle, find the two angles. (2 Marks)

Answers

Answer:

FIRST ANGLE = 21 degree

SECOND ANGLE = 119 degree

Step-by-step explanation:

140 = 6x - 7 + x

140 = 7x - 7

combine like terms

140 + 7 = 7x

147 = 7x

x = 21

second angle = 6(21) - 7 = 119

Worth 12 points and actually help me with the question plz

Answers

Answer:

(x + 1, y - 3)

Step-by-step explanation:

The translation is 1 unit right and 3 units down.

Answer:

x+1 y-3

Step-by-step explanation:

Because with any of the points it goes to the right 1 and down 3

Suppose the 100 people in society X all know the same 10 facts, while the 10 people in society Z specialize, with each person knowing 5 unique facts as well as 5 facts also known by the other 9 members of the society. If the standard of living is roughly equivalent to the average number of social facts known per person, which society has a higher standard of living

Answers

Answer:

29 times

Step-by-step explanation:

Given :

Society X ;

Population = 100

Number of facts known = 10

Average fact known per person = known fact / population = 10 / 100 = 0.1

Society X:

Population = 19

Common fact known by 9 = 5

Specialized fact, known by 10 = 5 * 10 = 50

Total facts = common + specialized = 55

Average fact known per person = 55 / 19 = 2.8947368 fact per person

Number of times society Z is better :

2.8947368 / 0.1 = 28.947 times

Approximately 29 times

help please and thank you

Answers

Answer:

40° D. is your answer to this question

The points (6, 9) and (0, 6) fall on a particular line. What is its equation in slope-intercept form?

Answers

Answer:

[tex]y = \frac{1}{2}x + 6[/tex]

Step-by-step explanation:

[tex]Let \ (x _1 y _ 1 ) = ( 6 , 9 ) \ and \ (x _ 2 , y _ 2 ) \ = ( 0 , 6 )\\\\[/tex]

Step 1 : Find slope, m

              [tex]slope, m = \frac{y _ 2 - y _ 1}{x_ 2 - x_ 1 } = \frac{6 - 9}{0 - 6 } = \frac{-3}{-6} = \frac{1}{2}[/tex]

Step 2 : Find the equation

                [tex](y - y _ 1 ) = m ( x - x_ 1) \\\\( y - 9 ) = \frac{1}{2} (x - 6 ) \\\\y = \frac{1}{2}x - 3 + 9 \\\\y = \frac{1}{2}x + 6[/tex]

Answer:

y = 1/2x + 6

Step-by-step explanation:

y = mx + b is the formula. m is the slope and to calculate that you use the slope formula y2 - y1/ x2 - x1.

(6, 9)  is the first coordinate so 6 is x1 and 9 is y1. Similarly in (0, 6), x2 is 0 and y2 is 6. Now if we put that into the slope formula it would look something like this: 6-9/0-6. that comes to -3/-6. simplify and cancel out the negatives and you get 1/2 which is the m ( slope).

The b is the y-intercept, which is the y value for where the x is 0. In this question, they already give you the coordinate where x is 0. (0, 6). x is 0 and y is 6. therefore the b (y-intercept) is 6.

Put all of this into y =mx +b, and you get y= 1/2x + 6.

If you want to make sure you did it right, just plug in one of the coordinates into this equation. Let's use  (6, 9).

9 = 1/2 (6) + 6

9 = 3 + 6

9 = 9. It works out, therefore the equation right.

Hope this helps

Other Questions
Consider Hermia's first words when she enters the scene. How do her comments about the setting relate to the action of the scene? In particular, how might Shakespeare intend a double meaning here for her use of the word "sense"? A woman sold an article for 20.00cedis and made a profit of 25%.Find the cost price of the article. What is the sign of -9. (0/-3) If a firm's marginal tax rate is increased, this would, other things held constant, lower the cost of debt used to calculate its WACC. True False When evaluated, which expression has a result that is a rational number? How does convection cause ocean currents?A. During the process of convection, energy is transferred to the atmosphere forming winds. These winds power surface currents.B. During the process of convection, the heating of surface water by the sun results in upwelling.C. During the process of convection, energy in warm water is lost to its surroundings. The water cools, becomes denser, and sinks.D. During the process of convection, more minerals and gases dissolve in warm water. This increases the density of the warm water and causes it to sink. The angle of elevation to a nearby tree from a point on the ground is measured to be31. How tall is the tree if the point on the ground is 62 feet from the tree? Roundyour answer to the nearest tenth of a foot if necessary. Lighting is the movement of? A business manager finds that the building expense each month is completely uncorrelated with revenue levels. What should the business manager assume about this cost? What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 HELP 18 POINTSJournal prompt to be answered in 2 fully developed paragraphsPrompt: How does physical activity prevent disease and reduce health care costs? Use specific examples from your experience. how can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededhow can an irreverible step in a metabolic pathway be reversed?A. When both the reactants and products have equal amounts of energyB. When the reactants contain large amounts of energyC. When another chemical reaction with a large amount of energy occurs at same time D. when collision of substances generate the energy neededOrder the sequence of events in transcription?1- free ribonuleotide triphosphates base-pair with the deoxyribonucleotides in the DNA template 2- RNA polymerase binds to the promoter region of a gene3- primary rna transcript is formed 4- two DNA strands are seperatedWhich organic molecule is not found on the plasma membrane?A. carbohydratesB. cholestrolc. phospholipidsd. proteinsWhat does this statement mean : "Information flow between cells tissues and organs is an essential feature of homeostasis and allows for integration of physiological processes"A. the nervous system is the most prominent body system for integration of physilogical processes B. some substances can affect local processes while others travel to exert their effects on other distant parts of the bodyC. communication between body structures through body fluids is the most important physiological processesD. Neurotransmitters, hormones, paracrine and autocrine substances exert their efferts locally as well as distant body structureswhich statement best describes the orientation the phospholipid molecules in a membrane:A.) the nonpolar fatty acids are oriented towards the cholestrol moleculesB.) the hydrophilic layer is oriented towards the middle of the phosphlipids C.) phospholipids align themselves in the membrane in a bimolecular layerD.) the hydrophobic and hydrophilic structures point away from the cellWhich is NOT a product of glycolysis under aerobic and anaerobic conditions?A.) lactate B.) FADH C.) pyruvate D.) NADH Which reason is why water is an essential nutrient? A.) water needs to move between compartmentsB.)can be obtained through ingestionC.) body cant make enough water for its needsD.) water evaporates from the skin that has the largest surface area among all body structures From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Which guarantees do the Sixth and Eighth Amendments to the Constitution make?the right of all citizens to keep and bear arms and freedom from illegal searches and seizures conducted without search warrantsthe right of arrested persons to remain silent when in custody and the freedom to peacefully assemble and protest the actions of the governmentthe right to be brought before a judge to decide whether ones imprisonment is legal and the freedom to file lawsuits based on federal, state, and local statutesthe right of accused persons to be defended by a lawyer in a speedy public trial and freedom from cruel and unusual punishments and excessive bail Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Tia and Sam are partners who solely own T and S Florist. As owners, they can:______.a. claim the organization as their legal property. b. can't sell the company. c. claim only limited liability. d. avoid taking any legal responsibility for T and S. e. decide not to pay a dividend to their stockholders. HELP ASAP 30 POINTS WORTH !!!!! OO The slope of a line is 2. The y-intercept of the line is 6. Which statements accurately describe how to graph the function? Locate the ordered pair (0, 6). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (0, 6). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, right 1 to locate the next ordered pair on the line. Draw a line through the two points. Locate the ordered pair (6, 0). From that point on the graph, move up 2, left 1 to locate the next ordered pair on the line. Draw a line through the two points. Please help!!!hi,can you please help me with this?thanks can someone answer this please