A hunter 1.6m tall, views a bird on top of a tree at anangle of 45°. If the distance between the hunter and thetree is 10.4 m, find the height of the tree​

Answers

Answer 1

Answer:

The height of the tree is 12 m

Explanation:

Please check the image uploaded for diagram and solution.

A Hunter 1.6m Tall, Views A Bird On Top Of A Tree At Anangle Of 45. If The Distance Between The Hunter

Related Questions

Which activity is one of the two adaption processes purposed by piaget in his theory of cognitive development?
A. Interpretation
B. Perception
C. Accommodation
D. Acceptance

Answers

A because the interpretation intersects the crust causing an interception

NOUVET
[tex]6343434 = = 4 = 3y[/tex]

Answers

Which word could you use to describe the author's purpose in an argument?

Convince

Describe

Entertain

Inform

What are the barriers which prevent you from participating in leisure activities?​

Answers

cost, lack of time, distance, and lack of physical ability.
Money, time, disability and accessibility

8. People often take____
to manage the symptoms of schizophrenia.

antidepressants

antipsychotics

stimulants


WHICH ONE PLZZZ HELP

Answers

Answer: methamphetamines

Explanation:

Antiphcotics Bc schizophrenia is when you feel like things are to real and u feel crazy so it would be the 2nd one

Discuss the role of a social worker in caring for the elderly.​

Answers

Answer:

well they will make sure that the person is well taken care for if the people can not take care of then for themselves and the socail worker will help them with t=when they have tantruims and there behavior is not how it should be so they are there for behavior and to help when needed

Explanation:


Pls help, I mark u brainlist if is right!!

On an interdisciplinary team, the decision making___

a. is done by the core medical personnel

b.occurs only when the patient is discharged

c. takes into account the views and information
gathered from all involved

d. is the responsibility of the doctor in charge

Answers

Answer: C

Explanation: Decision making in an interdisciplinary team occurs at the interface between groups with varied backgrounds, orientations, interests, and goals.

CREDIT: pubmed

A client in the intensive care unit who has a brain tumor has experienced a sharp decline. The care team suspects that water and protein have crossed the blood–brain barrier and been transferred from the vascular space into the client's interstitial space. Which diagnosis best captures this pathophysiology? *

Answers

Answer:

vasogenic edema

Explanation:

Vasogenic edema is defined as extracellular accumulation of fluid resulting from disruption of the blood-brain barrier (BBB) and extravasations of serum proteins, while cytotoxic edema is characterized by cell swelling caused by intracellular accumulation of fluid.

Which of these health risks may be caused by sleep deficiency

Answers

Answer: I am going to assume some things cause i don't have enough details

Health Risks Caused By Sleep Deficiency

- Increased Stress.  

- Weakened Immune System.  

- Weight Gain

- Impaired Cognitive Function

- Mood Changes

Answer: Immune suppressin

Explanation: because you need sleep kid

Hello, can somone give me more ideas on ''safety procedures for equipment'to use' its for a slide project.(no links please)

Answers

1. Never remove or try to defeat machine safeguards.

2. Don’t create new hazards, such as allowing objects to fall into the moving parts or by creating a new pinch point.

3. Report problems with machine safeguards to your supervisor immediately.

4. Never leave machines unattended with parts still moving. Remember that parts may still be moving after the machine has been turned off.

All the safety training you need in one program: 25 subjects, one low price. It’s BLR’s Safety Training Presentations. Try it out and get a Free Special Report. Get the details.
5. Remove guards only when the machine has been locked out and tagged out.

6. If possible, lubricate machine parts without removing the safeguard; otherwise, turn the machine off and lock it out before lubricating.

7. Operate equipment only when guards are in place and properly adjusted.

8. Do not use unauthorized or damaged guards.

9. Do not wear loose clothing, jewelry, or long hair around machines—these increase the risk of being caught in the machinery.

10. Ask your supervisor if you have any questions about a machine safety or how to work with machine guards safely.

Please help : )

Using the picture above, come up with three vegetarian meals that include complementary proteins. In a separate paragraph, explain the importance of incorporate complementary proteins within the vegetarian diet as well as the risks of don’t doing so.

Answers

Answer:

1. Ground cashews, lentils, and bok choy on rice. Easy-cook meal for vegans :D

2. Kidney beans, tomatoes, cashew cheese, and corn chips. Perfect vegetarian nachos :D

3. Cashew spinach dip, hummus, and chips. Light snack for vegans :D

Protein is needed for the body to grow and stay strong. Protein also creates fat which is needed for a healthy weight. Without taking in protein you may be underweight, weak, and tired.

Explanation:

I hope this helps <3

PLEASE HELP ME!!!!!!!!!!!!!!!!!! What type of advertisement should you be careful of accepting as truth? (1 point)
O an ad stating a product contains "special" or "secret” ingredients
Oan ad that states the product has published consumer-tested results
O an ad for a medicine that states it has gone through government testing and is proven safe
O an ad for dog food claiming 9 out of 10 dogs like their beef-flavored brand

Answers

An ad stating a product contains special or secret ingredients

What is the correct definition of group team sports?
A. Sports in which only one player per team competes at a time, with
individual scores counting toward the team score.
O B. Sports consisting of more than one player on the field or court at a
time.
C. Sports which cannot be played by fewer than five people per team.
D. Sports which cannot be played by fewer than ten people per team.

Answers

Answer:

b

Explanation:

it is the answer cause u cant just hhv more than 5 players and call that a tea

I’m agree it’s the answer is B

Walking can improve your posture?

Answers:
True
False

Answers

True because walking can improve your posture

Answer:

True,

yes Walking can improve your posture

Recommendation grade B it is conclusion of a meta-analysis.

1)True

2)False

Answers

Answer:

true

Explanation:

True is the answer ur welcome

Both Center lines are broken?
Of driving

Answers

Need more info to answer

Interpret the poster below.(Atleast 50 words)

Answers

Answer:Everyone benefits from gender quality.Gender equality helps prevent violence against women and girls and makes our communities safer and healthier.it is a human right and it is good for the economy

#Brainlestbunch

Which of these eating disorders involves binging on large
amounts of food followed by purging in an attempt to avoid
weight gain?
O Anorexia nervosa
O Bulimia nervosa
O Obesity

Answers

Answer:

That would be Bulimia Nervosa :)

Explanation:

knees caving inward during a squat is also known by what term?

Answers

Answer:

This is sometimes called knee valgus, valgus collapse, or some combination of the two.

Explanation:

m-5=6 .working please​

Answers

Answer:

here you go !

Explanation:

m-5=6

+5 +5

m= 11

Answer:

m=6+5

add five to both sides of the equation you get:

m=11

can become weaker. This is due to
With age, muscles
With age, muscle can become weaker. This is due to ______.

A. Connections between nerves, which cause more pain and therefore less use
B. Damage from everyday use and injuries that accumulate over time.
C. Disconnections between motor nerves and muscle fibers.
D. Difficulties that occur during muscle growth and repair.

Answers

I think the answer is D and the reason why is because connections between nerves are more painful therefore
The answer is c.disconnections between motor nerves and muscle fibers

Which is the most complex of the emotional competencies?

Answers

Answer:

I think deppreson.

Explanation:

The most complex of the emotional competencies is: Regulating emotions.

Psychology refers to the scientific study of both the consciousness and unconsciousness of the human mind such as feelings, emotions and thoughts, so as to understand how the human mind functions and affect human behaviors in contextual terms.

An emotional competence can be defined as a set of personal and social abilities or skills possessed by an individual, that helps him or her to recognize, analyze, interpret, manage and respond constructively to emotions in oneself and others.

Hence, an emotional competence is the functional ability of an individual to reach his or her goals after expressing emotions with complete freedom or an emotion-eliciting encounter.

According to psychologists, the regulation of emotions is considered to be the most complex of the emotional competencies because it is often difficult to manage or control emotions.

Find more information here: https://brainly.com/question/14745910

describe the benefits and dangers of technology use in school-age programs?

Answers

Answer:

salami

Explanation:

you see, salami is better than brainly.

creates a more enhanced environment
incorporates different learning techniques
imporve collaboration skills
prepare children for the future

WILL GIVE 60 POINTS!!!!
Complete the following sentences about vital signs.
Complete the following sentences about vital signs.
Healthcare providers monitor four vital signs of patients—temperature, pulse, respiration, and blood pressure.

Temperature measures the heat
and
by the body.
The pulse measures the number of times the
beats in a minute.
The respiration rate measures the number of
a person takes in a minute.
The blood pressure is a measurement of the
of the blood against the walls of the
.
1st option for the 1st one is Lost or Found
Option for the 2nd one Produced or gained
Option for the 3rd one Brain or Heart
Option for the 4th one Breaths or Breaks
Option for the 5th one Flow or Force
Option for the 6th one Veins or Arteries

Answers

Answer:

The correct answer is:

1. lost 2. gained 3. heart 4. breaths 5. force 6. arteries.

Explanation:

The temperature is the amount of heat of an organism or object. In simple words, it is the warmth of an object. The temperature measures the heat lost and gained by the body to or from the surrounding.

The pulse is the rhythmic dilation of the opening and closing of aortic valves in the heart which makes the lub-dub sound and also known as heartbeats.

The rate of breath per minute by an organism is the respiration rate of the organism. Blood pressure is the force that is applied by the blood on the walls of the vessels or arteries.

Answer:
Blank 1: Lost
Blank 2: Produced
Blank 3: Heart
Blank 4: Breaths
Blank 5: Force
Blank 6: Arteries

Explanation:

I got all of them right except one blank, which would be Produced not Gained. Picture below:

2
3
5
6
7
8
Emotional health is a person's ability to express feelings appropriately.
Please select the best answer from the choices provided.
ОТ
OF

Answers

Answer:

T

Explanation:

Brainliest plz.

Emotional health is a person's ability to express feelings appropriately; that is false, as emotional health is defined as the state of being able to express and manage emotions in a healthy and appropriate way.

What is emotional health?

It is a complex and multifaceted concept that refers to the ability to understand, express, and regulate emotions in a healthy and appropriate way, and emotional health involves being able to recognize and manage one's own emotions, which involves many factors such as self-awareness, which involves being in tune with one's own emotions and recognizing how they affect thoughts, behaviors, and relationships; self-regulation, empathy, and resilience are also needed.

Hence, emotional health is a person's ability to express feelings appropriately; that is false.

Learn more about emotional health here.

https://brainly.com/question/16713850

#SPJ7

Brainliest if answer correctly.
Write an essay describing the process of digestion, starting from your mouth and traveling down through your body all the way to the rectum.

Answers

Explanation:

 The digestive system happens in the first stage. First, you bite into the food. Secondly, your front teeth tear food, and your back teeth crush and grind the food. Then, the tongue rolls the food back and the glands release Saliva, and the food turns into the bolus. Finally, you swallow the bolus passes the pharynx that’s in your throat, and goes down the esophagus. The first stage is where the digestive system happens.

   The second stage of the digestive system takes place in the stomach. First, chemicals break down the bolus into nutrients. Next, the muscle of the stomach squeezes and relaxes. Then, the muscle actions mix up the bolus and chemicals. Finally, after four to six hours of squeezing and mixing the bolus turns into liquid. The digestive system happens in the stomach in the second stage.

   The third stage of the digestive system happens in the small and large intestine. First, the pancreas adds juice that digests most of the food, and the liver adds bile that gets rid of fat. Secondly, the juices mix with the food until it’s broken into nutrients, the folds in the wall soak up the nutrients. The nutrients pass into tiny blood vessels in the fold then blood carries the nutrients to the cell. Finally, food goes through three parts the cecum, colon, rectum.

answer with any answer

Answers

Answer:

nice

Explanation:

Answer:

9 + 10 = 21

Explanation:

Thanks for the free points

6. Which factor does not impact the complexity of an incident? A. Cost considerations of responding agencies
B. Community and responder safety
C. Political sensitivity, external influences, and media relations
D. Potential hazardous materials

7. Mutual Aid Agreements ________________________________
. A. are limited to the exchange of resources between neighboring states.
B. are mandated in state and county emergency management budgets.
C. assist agencies and jurisdictions when existing resources are inadequate.
D. base their assistance on the equivalent monetary value of shared resources.

8. Which statement best describes ICS Form 201?
A. Lists all resources and organization assignments for the upcoming operations period
B. It is completed by the Safety Officer in order to address safety concerns and identify mitigation measures.
C. It allows a Single Resource Unit Leader to track major activities during each operational period.
D. It contains status information for briefing the incoming Incident Commander or other incoming resources.

9. To ensure a smooth transfer, the outgoing Incident Commander should provide a ___________ to the new Incident Commander. A. Situational Analysis Document
B. Transfer of Command Briefing
C. Lessons Learned Report
D. List of personnel staffing each Section

10. Which of the following is NOT part of the NIMS Management characteristic of Chain of Command? A. Avoids confusion by requiring that orders flow from supervisors.
B. Allows the Incident Commander to control the actions of personnel under his or her supervision.
C. Restricts personnel from sharing information with each other.
D. Details how authority flows through the incident management organization.

Answers

Answer:

well thats a lot of questions

Explanation:

diont really know man goodluck

Answer:

rtytygyrtyFfjgkemgUifjgkejrgCfdkgmiKidffn#e

?.flmg

Explanation:

trytrtya 4ery5tyth srmgfcgrawre teDICKRGVG

Help me and I’ll give brainliest to ya and if u dunno don’t answer

Answers

The endocrine system consists of several glands, including the pituitary gland and hypothalamus in the brain, adrenal glands in the kidneys, and thyroid in the neck, as well as the pancreas, ovaries and testes. The stomach, liver and intestines also secrete hormones related to digestion.

Answer:

The endocrine system consists of several glands, including the pituitary gland and hypothalamus in the brain, adrenal glands in the kidneys, and thyroid in the neck, as well as the pancreas, ovaries and testes. The stomach, liver and intestines also secrete hormones related to digestion.

Explanation:

free brainlyy cuzwhy not :3

Answers

Answer:

aw ty <3 stay safe!

Explanation:

Hiii! I don’t need brainlest, just points but I hope you have a nice day

EXPLAIN
======================

Answers

Answer:

B

Explanation:

Integumentary system is skin, hair, nails, glands.

Other Questions
What is Isolated system How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCATCATCATCATCATTTAAGCTTCAAAGCTT At one time, dinosaurs were rulers of the earth. What are the nouns? Hello, I need help in this part of chemistry, I need the chemical names of the following four:1) B and F32) Se and I23) As2 and Se3ASAP! Please,,, 25 ft 8 yd 11 in.Which is greater? NO SCAM LINKS. please reply ASAP PLEASEEEE I'LL GIVE YOU BRAINLIEST!!Which is the best definition of air pressure? *1 pointthe weight of the air pressing on everything in the environmentthe amount of precipitation in a certain areathe type of clouds in the atmospherethe amount of water vapor in the air I have to find the missing angles In what Century did people learn how traits pass from one living being to itsdescendants? Find the sum or typeimpossible"Help Resources[1 -2 1] + [4 -5 -6]Skip[[?]Enter Texas Roadhouse opened a new restaurant in October. During its first three months of operation, the restaurant sold gift cards in various amounts totaling $1,800. The cards are redeemable for meals within one year of the purchase date. Gift cards totaling $728 were presented for redemption during the first three months of operation prior to year-end on December 31. The sales tax rate on restaurant sales is 4%, assessed at the time meals (not gift cards) are purchased. Texas Roadhouse will remit sales taxes in January.Required:a. Record (in summary form) the S3,500 in gift cards sold (keeping in mind that, in actuality, the firm would record each sale of a gift card individually). b. Record the S728 in gift cards redeemed. c. Determine the balance in the Deferred Revenue account (remaining liability for gift cards). HEY CAN SOMEONE HELP ME WITH MY LASTEST MATH QUESTION I WILL GIVE BRAINLIST PLEASE :))) The owner of Chips etc. produces two kinds of chips: lime (L) and vinegar (V). He has a limited amount of the three ingredients used to produce these chips available for his next production run: 4800 ounces of salt, 9600 ounces of flour, and 2000 ounces of herbs. A bag of lime chips requires 2 ounces of salt, 6 ounces of flour, and 1 ounce of herbs to produce; while a bag of vinegar chips requires 3 ounces of salt, 8 ounces of flour, and 2 ounces of herbs. Profits for a bag of lime chips are $0.40, and for a bag of vinegar chips $0.50. Match the western nations to their coloniesUnited StatesFranceGreat BritainThe Netherlands evaluate 3 + jk + k ^3 when j = 2 and k = 6 Which one is not an adverb ?HappySlowlyVery Which is the simplified form of p? O p O 1/p O 0 O 1 PLEASE HELP ME!!!! I'M ALMOST OUT OF TIME!! What are the degree and leading coefficient of the polynomial? During his past seven basketball games, Manuel scored 35, 37, 43, 47, 52, 29, and 31 points respectively. Therefore, his mean number of points per game was 39.14.What did calculating that number tell him about his game? A. Manuel would know that he will make at least 39 points per game in the future. B. Even though Manuel does not score exactly 39 points in every game, he tends to score on average 39 points per game. C. Manuel would know that he will make at most 39 points per game in the future. D. Manuel would know that both he and his teammates will contribute an average of 39 points each per game.