–4x-2y=-2
x-2y=9
what do you get if you subtract the second from the first

Answers

Answer 1

Answer:

-4×-2y=2

-4×+8y=-8

6y=6

y=1 then you the value of y and to put in any one equestion


Related Questions


polynomial expression
6x2 + 10x - 56

Answers

Answer:

-34

Step-by-step explanation:

Answer:

The answer is  34

Step-by-step explanation:

i was following the order of PEMDAS (parenthesis, exponents, multiplication, division, addition, subtraction)

so i did 6x2 which got me to 12 and then I added 10 which gave me 22, and then lastly i subtracted 56-22 which gave me 34.

~Hope this explanation has helped you, have a great day/ night!~

Find the equation for the circle with center (3,−5) and diameter of length 8.

Answers

Answer:

(x-3)² + (y+5)² = 16

Step-by-step explanation:

Radius will be half of diameter means that radius = r = 8/2 = 4.

With Center (h,k) the equation of circle is

(x-h)² + (y-k)² = r²

so by putting values answer will be

(x-3)² + (y+5)² = 4²

(x-3)² + (y+5)² = 16

Tina contributes 9.5% of her monthly salary towards her 401(k) and her employer matches her contribution up to 5.4% of her annual salary. If the interest rate of her 401(k) is 8.1% compounded monthly and her monthly salary is $2,461, determine the amount in her account after 25 years. Round to the nearest cent.
a.
$339,804.33
b.
$354,452.86
c.
$344,941.24
d.
$347,269.59



Please select the best answer from the choices provided


A
B
C
D

Answers

Answer:

In 25 years, Tina will have $354,452.86

Step-by-step explanation:

Monthly Contribution - $366.69 (Tina & Employer)

Length of Time in Years - 25

Estimated Interest Rate - 8.1%

Compound Frequency - Monthly

Write an equation, and then solve.
5. Kiesha and Wanda went to the mall for 4.5 hours. While they were there, they went to a movie that lasted 130
minutes and ate dinner for 70 minutes. They spent the rest of the time walking around the mall. How long did
they spend walking around the mall?

Answers

Answer:

70 mins

Step-by-step explanation:

Lets first convert the 4.5 hours to minutes. We know that there's 60 mins in an hour, so we can just multiply 4.5 by 60 to get 270 minutes. Now we know the total time spent at the mall.

Then, we can add the times given in the question.

130 mins + 70 mins + walking mins = 270 mins

To solve, simply collect like terms:

200 mins + walking mins = 270 mins

walking mins = 270 mins - 200 mins

walking mins = 70 mins

Find the missing value in the percent statement using a proportion.
______ is 75% of 4.

Answers

Answer: 3

Step-by-step explanation: Hope I helped

I GIVEEE BRAILILSTTTTTTTT

Answers

Answer:

umumumuykik.iu.fg

Step-by-step explanation:

lui;iou;uyfluylfuy;lui;uy;

please solve question in picture branoist to first and correct​

Answers

Answer:

The correct answer is Option 3: 12y

Step-by-step explanation:

A polynomial term is usually made of a variable and a co-efficient.

Like terms are those terms that have the same variables i.e. x and 44x are like terms.

Given expression is:

[tex]6y-2y+8y[/tex]

All the terms have only y which means that all three terms are alike.

The coefficients of like terms are added or subtracted according to their sign.

[tex]6y-2y+8y[/tex] = 12y

Hence,

The correct answer is Option 3: 12y

Tyree and four friends go to the movies. Each person buys a movie ticket for $7, a snack for $5, and a drink for $2. Write an expression for the total cost of the trip to the movies. Then find the total cost.

Answers

Answer:

Tyree and all of his friends get 1 ticket for $7. Next they all get 1 snack for $5. Then they all get a drink for $2. So:

1=7

1=5

1=2

Then you take each person (which there are five of then) and you times all five people by 7, 5, 2.

5 x 7=35

5 x 5=25

5 x 2=10

After that you add it all together:

35 plus 25=60

60 plus 10=70

Step-by-step explanation:

your welcome

Answer:

Im not sure if it ment, Tyree and four friends go to the movies. Each person buys a movie ticket for $7, a snack for $5 (meaning only one snack), and a drink for $2. (Meaning only one drink) or if it ment Tyree and four friends go to the movies. Each person buys a movie ticket for $7, a snack for $5 (meaning everyone got a snack), and a drink for $2(meaning everyone got a drink). So i did the math for both of them, if they only got 5 tickets, one snack, and one drink, it would be 42 (the math problem is 35 + 2 + 5). if they got 5 tickets, 5 snacks, and 5 drinks, it would be 70(the math problem is 35 + 25 + 10). Hope this helps!

What is the solution to the system of equations? =6x=y=8 5x+3y = 29 (10,-2) (10, 2) O (2, 10) (-2, 10)​

Answers

Its the 2nd one in the picture

Which expression demonstrates the use of the commutative property of addition in the first step of simplifying the expression (–1 + i) + (21 + 5i)? (–1 + i) + (21 + 5i) + 0 –1 + (i + 21) + 5i (–1 + 21) + (i + 5i) –(1 – i) + (21 + 5i)

Answers

Answer:

i think the answer is C, (-1 + 21) (i + 5i)

Step-by-step explanation:

i just took the test and got a 92% but it didnt tell me which ones were wrong. thats my best guess though. i hope it helps!

The expression demonstrates the use of the commutative property of addition in the first step of simplifying the expression as, (-1 + 21)+(i + 5i). Option C is correct.

What is an expression?

It is defined as the combination of constants and variables with mathematical operators.

It is given that the expression is, (–1 + i) + (21 + 5i)

We have to find the expression that demonstrates the use of the commutative property of addition

According to the commutative property of addition, altering the order of addends has no impact on the sum.

Commutative law refers to either of two rules pertaining to the addition and multiplication of numbers that are expressed symbolically as a + b = b + a and ab = ba. These principles imply that rearranging the terms or factors of any finite sum or product has no effect on it.

Thus, the expression demonstrates the use of the commutative property of addition in the first step of simplifying the expression as, (-1 + 21)+(i + 5i). Option C is correct.

Learn more about the expression here:

brainly.com/question/14083225

#SPJ6

Could somebody pls help me with this question

Answers

simplify to 1 hour which will be 6 minutes in 1 hour

in 3 hours it will be 18 minutes

Answer:

18 minutes is the answer

Step-by-step explanation:

•Time couple rested in 2 hrs = 12 min

•Time couple rested in 1 hr = 12/ 2 min = 6min

•Time couple rested in 3 hrs = 6×3 min = 18 min

HOPE IT HELPS YOU

MARK ME AS BRAINIEST

AND YOU CSN THANK ME IN THE COMMENT

(15 POINTS) Select the correct answer.
Which equation has infinitely many solutions?

A. -5(x + 2) = -4x - 12 - X + 2
B. 3x – 4 + 2x = 5(x-4)
C. 5(x + 7) = -5(X - 7)
D. 6x + 2 - x = -2x - 2 + 7 x

Answers

A. -5(x+2)=-4x-12-X+2

102 - Harder brackets
Find an expression without brackets
for the area of each rectangle.
(x + 3)
area =
12)
No
calc
р
(-9)
Total
area =
121​

Answers

Answer:

For figure 1:

Area of rectangle = 7x + 21

For figure 2:

Area of rectangle = [tex]\mathbf{p^2-9p }[/tex]

Step-by-step explanation:

We need to find area of rectangle

The formula used is: [tex]Area\:of\:rectangle=Length\times Width[/tex]

For figure 1:

Length = 7

Width = x+3

Putting values in formula and finding area of rectangle

[tex]Area\:of\:rectangle=Length\times Width\\Area\:of\:rectangle=7\times (x+3)\\Now,\: multiply\:7\:with\:terms\;inside\:the\:bracket\\Area\:of\:rectangle=7(x)+7(3)\\Area\:of\:rectangle=7x+21\\[/tex]

So, area of rectangle = 7x + 21

For figure 2:

Length = p

Width = p-9

Putting values in formula and finding area of rectangle

[tex]Area\:of\:rectangle=Length\times Width\\Area\:of\:rectangle=p\times (p-9)\\Now,\: multiply\:p\:with\:terms\;inside\:the\:bracket\\Area\:of\:rectangle=p(p)-p(9)\\Area\:of\:rectangle=p^2-9p\\[/tex]

So, area of rectangle = [tex]\mathbf{p^2-9p }[/tex]

(-7-3i)(11-8i)
Simplified into the a+bi form

Answers

Answer: what

Step-by-step explanation:

An SAT prep course claims to improve the test score of students. The table below shows the scores for seven students the first two times they took the verbal SAT. Before taking the SAT for the second time, each student took a course to try to improve his or her verbal SAT scores. Do these results support the claim that the SAT prep course improves the students' verbal SAT scores?

Let d=(verbal SAT scores prior to taking the prep course)−(verbal SAT scores after taking the prep course)d=(verbal SAT scores prior to taking the prep course)−(verbal SAT scores after taking the prep course). Use a significance level of α=0.1 for the test. Assume that the verbal SAT scores are normally distributed for the population of students both before and after taking the SAT prep course.

Student 1 2 3 4 5 6 7
Score on first SAT 500 380 560 430 450 360 560
Score on second SAT 540 470 580 450 480 400 600

Required:
a. State the null and alternative hypotheses for the test.
b. Find the value of the standard deviation of the paired differences. Round your answer to one decimal place.
c. Compute the value of the test statistic. Round your answer to three decimal places.
d. Determine the decision rule for rejecting the null hypothesis. Round the numerical portion of your answer to three decimal places.
e. Make the decision for the hypothesis test.

Answers

Answer:

Since the calculated value of t = -0.215  falls in the critical region so we accept Ha that SAT prep course improves the students' verbal SAT scores and reject the null hypothesis at significance level 0.05.

e. These results support the claim that the SAT prep course improves the students' verbal SAT scores.

Step-by-step explanation:

Student                        1      2      3       4      5         6          7

Score on first SAT    500   380 560   430  450    360    560

Score on second SAT 540 470 580  450    480    400    600

Difference d                -40  -90   -20    -20    -30     -40     -40     ∑ -280

d²                               1600  8100 400 400   900   1600  1600   ∑14600

a. Let the hypotheses be

H0:  ud= 0      against the claim Ha: ud ≠0

The degrees of freedom = n-1= 7-1= 6

The significance level is 0.05

The test statistic is

t= d`/sd/√n

The critical region is ║t║≤ t (0.025,6) = ±2.447

d`= ∑di/n= -280/7= -4

Sd²= ∑(di-d`)²/n-1 = 1/n-1 [∑di²- (∑di)²n]

= 1/6[14600-(-4)²/7] = [14600-2.2857/6]= 2432.952

b. Sd= 49.3249= 49.325

Therefore

c. t= d`/ sd/√n

t=   -4/ 49.325/√7

t= -4/18.6435 = -0.2145= -0.215

d. Since the calculated value of t = -0.215  falls in the critical region so we accept Ha that SAT prep course improves the students' verbal SAT scores and reject the null hypothesis at significance level 0.05

e. These results support the claim that the SAT prep course improves the students' verbal SAT scores.

Question 16 please help me

Answers

The answer is 32.8 this is because using the Pythagorean it’s a”

Algebraic Expression
43 times greater than
the sum of 57 and 93​

Answers

The algebraic expression is the following

43(57+93)

You’re going to want to put into parentheses the numbers 57 and 93 anytime you are asked for the sum of two numbers. Of course you would want to complete that portion of the algebraic expression first (PEMDAS) then you would want multiply that by 43 to make it 43 times greater.

43(150)

The final answer to the expression is 6,450

Please help ASAP!! 20 points givin

Answers

Answer:

d or b

Step-by-step explanation:

quick math

Answer is A 5/3
Hope it helps :)

What is the common factor of 26 and 38

Answers

Answer: The GCF is 2 and the LCF is 1

Step-by-step explanation:

What do you get when you cross an electric eel and a sponge puzzle time riddle

Answers

Answer:

A shock absorber?

Step-by-step explanation:

5x - 3 (x+3) = what to have infinitely many solutions

Answers

Answer: 1/4

Step-by-step explanation: I think that’s the answer! i’m sorry i’m in 8th fe are

Write an expression that represents the number of shells in pile 2.

Answers

Answer:

2

Step-by-step explanation:

4/2=2

7 1/2 + X + 15? What is X?

Answers

Answer;
22.5
Explanation;
7 1/2 + 15
-22.5

7.5+15+x=0
22.5+x=0
x= -22.5

Need Heeeeeelp please ...

Answers

the answer is red of all

[Calculus] analyze speed from position. Show steps, please!

Answers

Answer:

B

Step-by-step explanation:

We are given that the position of a particle is modeled by the function:

[tex]s(t)=2t^3-24t^2+90t+7[/tex]

And we want to find the times for which the speed of our particle is increasing.

In other words, we want to find the times for which our acceleration is positive (a(t)>0).

So first, we will find our acceleration function. We can differentiate twice.

By taking the derivative of both sides with respect to t, we acquire:

[tex]\displaystyle s^\prime(t)=v(t)=\frac{d}{dt}\big[2t^3-24t^2+90t+7\big][/tex]

Differentiate:

[tex]v(t)=6t^2-48t+90[/tex]

This is our velocity function. We can differentiate once more to acquire the acceleration function. Therefore:

[tex]\displaystyle v^\prime(t)=a(t)=\frac{d}{dt}\big[6t^2-48t+90\big][/tex]

Differentiate:

[tex]a(t)=12t-48[/tex]

If our speed is increasing, our acceleration must be positive. So:

[tex]a(t)>0[/tex]

By substitution:

[tex]12t-48>0[/tex]

Now, we can solve for t:

[tex]12t>48\Rightarrow t>4[/tex]

Therefore, the only interval for which the speed of the particle is increasing (i.e. the acceleration is positive) is for all times t>4.

So, our answer is B.

In one class, there are 2 of every 8 students in the class chewing
gum. If there are 32 students in the class, how many students are
chewing gum?

Answers

Answer:

8

Step-by-step explanation:

Answer:

8 people are chewing gum

Step-by-step explanation:

32/8=4, meaning there are 4 sets of 8 students.

If 2 students are chewing gum for every 8, and there are 32 students, that would mean that multiplying 4 by 2 to get 8 total kids chewing gum.

You could also say that 6*4=24, and 32-24=8 if you want to double check.

Hope this helps :)

Position vectors u and v have terminal points of (-6, 3) and (4, -2), respectively. Find the resulting terminal point of 2v - u.
(14, -7)
(2, 1)
(14, 1)
(2, -7)

Answers

Answer:

(14 , -7)

Step-by-step explanation:

terminal points: A (-6,3)   B (4,-2)

u = x₁ + i y₁    u = -6 + i3

v =x₂ + iy₂ = 4 - i2       2v = 8 - i4

2v - u = (8 - i4) - (-6 + i3) = 14 -i7

Resulting terminal point: (14 , -7)

Position vectors u and v have terminal points of (-6, 3) and (4, -2), respectively. Find the resulting terminal point of 2v - u.

(14, -7)

(2, 1)

(14, 1)

(2, -7)

Find the values of the variables in the parallelogram.

Answers

Step-by-step explanation:

We can find x very easily because the left and right sides are parallel,making the diagonal connecting them a transversal therefore x=33°

To find y we know that the sum of interior angles of a triangle is 180°

y+109°+33°=180°

y+142°=180°

y=38°

Now,

x+38°+z=180

33+38+z=180

z=180-71=109°

1-i need to mix 25% mineral spirits to the varnish i am using what ratio of spirit to varnish am i using? 2-if i use 240 ml of varnish what quantity of mineral spirits will i need in ml ? 3-Robison's tapestries all measure 1.5m x 1m wide. Express the proportion of the tapestries' heights to width using whole numbers. Give the answer in ration.

Answers

Answer:

(1) The required ratio of spirit to varnish is 1:3.

(2) You need 80 ml of mineral spirit.

(3) The ratio of tapestries' heights to width is 3:2.

Step-by-step explanation:

(1) If you need to mix 25% mineral spirit to the varnish, then the solution would contain 25% mineral spirit and 75% varnish.

So, [tex]\frac{spirit}{varnish}=\frac{25}{75}[/tex]

                  [tex]=\frac{1}{3}[/tex]

Thus, The required ratio of spirit to varnish is 1:3.

(2) If you use 240ml of varnish, then this quantity is 75% of the total solution or ration of varnish to the total solution will be 3:4.

Let [tex]x[/tex] be the quantity of total solution.

Then, [tex]240:x=3:4[/tex].

⇒[tex]\frac{240}{x}=\frac{3}{4}[/tex]

⇒[tex]3x=240*4[/tex]

⇒[tex]x=\frac{240*4}{3}[/tex]

⇒[tex]x=320[/tex]

That is, total solution is 320 ml.

Now, Spirit = Total solution - Varnish

⇒Spirit = 320ml-240ml

⇒Spirit = 80ml

Hence, if you use 240 ml of varnish, you need 80 ml of mineral spirit.

(3) Robison's tapestries all measure 1.5m long and 1m wide. First, we express dimensions in whole numbers by multiplying them by 10.

Then, dimensions are 15m long and 10m wide.

Now, Height : Width = 15:10

⇒[tex]\frac{Height}{Width} =\frac{15}{10}[/tex]

⇒[tex]\frac{Height}{Width} =\frac{3}{2}[/tex]

Hence, the ratio of tapestries' heights to width is 3:2.

The following data is from a simple random sample of 12 students GPAs. 3.12 2.45 4.0 3.76 3.54 2.78 3.39 3.21 1.98 3.43 3.98 2.77 Develop a point estimate of the population mean.

Answers

Answer: 3. 2

Step-by-step explanation:

Given the data:

3.12 2.45 4.0 3.76 3.54 2.78 3.39 3.21 1.98 3.43 3.98 2.77

Point estimate of population mean :

Σx / N

(3.12 + 2.45 + 4.0 + 3.76+ 3.54 + 2.78 + 3.39 + 3.21 + 1.98 + 3.43 + 3.98 + 2.77)

= 38.41 / 12

= 3.2008

Other Questions
The Venn diagram below shows some of the services provided by national and state governments.Which service completes the Venn diagram? (3 points)A. Raise and collect taxesB. Declare war and make peaceC. Make marriage lawsD, Coin and print money Solve: 68 x = 14 ( please i really need these super fast thank you! ) I need help ASAP please Which sentence is best structured to present two ideas of equal importance?A. Since NASA was founded, it has sent more than 250 astronautsinto space.B. The mission of NASA is to explore outer space.C. Some people think that NASA should focus on exploring theuniverse, but others believe that building a colony on the moon isthe most important goal, even though it will be difficult.D. NASA is known for sending humans to the moon, but the famousspace program has also sent an unmanned spaceship to Mars. DETERMINE THE MISSING SIDE Creative block! I WILL GIVE BRAINLIEST AND 5 STARS.... PLEASE HELP!!! using all my points for this!!!either give me a topic idea or the full essay it can be 240 words or something too my teacher will accept that. It is just for a lesson question so no pressure if it is 200 words or less I can work on it and add more words I just need a skeleton essay because I am having writers block."Select an environmental issue faced by the countries of this region. Write an essay of 300 words describing the problems presented by your chosen issue and possible solutions to the problem." A store is having a 20%-off sale on its video games. What is the amount of the discount on a game that regularly costs $25? What are the like terms in the expression: 2a + 3b+ 4C - 5a + 8 - 4THESE ARE THE OPTIONS 2,3,4, -5O 2a, 3b, 4c-5a, 82a, -5a, 8, -4HELPP What caused the original creation of the Universe? How do we find out? TACTTAGAGGCACCACATGGGCCTTGCACT to mRNA Please help with this Spanish work. The topic is Superlatives. THIS IS FOR DANCE IT IS STILL MY CLASS THERE IS JUST NO OPTION FOR ITWhat are some stretches you can do to increase flexibility in your legs? One-third of Olivia age , increased by 12 , is equal to twice her age , decrease by 3. How old is Olivia Lydia made 3 pounds of trail mix. One portion of trail mix is 19 pound. How many portions of trail mix did Lydia make? You know I never approved of it, pursued Utterson, ruthlessly disregarding the fresh topic.My will? Yes, certainly, I know that, said the doctor, a trifle sharply. You have told me so.Well, I tell you so again, continued the lawyer. I have been learning something of young Hyde.The large handsome face of Dr. Jekyll grew pale to the very lips, and there came a blackness about his eyes. I do not care to hear more, said he. This is a matter I thought we had agreed to drop.The Strange Case of Dr. Jekyll and Mr. Hyde,Robert Louis StevensonWhere in the plot is this passage found?the expositionthe rising actionthe falling actionthe resolution How do blood types react in a transfusin ? plz help me with this What current passes through a 1 kW heater with 25 V across it? 1) Choose the correct answer. I NEED HELP ASAPThe destination of many Roman Catholic pilgrimages was ______.the Holy Landthe Holy Roman EmpireAfricaKievRome The incidence of cystic fibrosis, a recessive genetic disorder in the Caucasian population of United States, is 1 in every 2,500 individuals. Find the number of heterozygous carriers. (p + q = 1, p2 + 2pq + q2 = 1) An appropriate strategy to learn difficult vocabulary words is the a. Keywords technique c. Rhyming Technique b. Visualization technique d. None of these Please select the best answer from the choices provided A B C D