3) The triangles shown are congruent using ASA, but they arb not marked completely. Mark the corresponding parts in this drawing that must be congruent in order to apply the ASA. Then write the congruence statement in the spaces provided. (2 pts) CAB FDE ____=____

3) The Triangles Shown Are Congruent Using ASA, But They Arb Not Marked Completely. Mark The Corresponding

Answers

Answer 1

Answer:

angle A = Angle E

ΔCAB ≅ΔFED

Step-by-step explanation:

ASA  means Angle side Angle Where the side is between the two angles

We have an angle C= F  and a side AC = EF

We need angle A = Angle E

ΔCAB ≅ΔFED


Related Questions

Place the following linear equation in slope intercept form: 6x - 4y = 9

Answers

Answer:

y = 3/2 x - 9/4

Step-by-step explanation:

bring all the y's to one side.

4y = 6x-9

divide by 4 to isolate the y

y = 6/4x - 9/4

simplify

y = 3/2 x - 9/4

Answer:

y = (3/2)x - 9/4

Step-by-step explanation:

Slope intercept form is

y = mx + b

------------------

6x - 4y = 9

subtract 6x from both sides

-4y = -6x + 9

Divide both sides by -4

y = (3/2)x - 9/4

- Andrew gave half of his money to support a local charity. From what was left, he spent
$22.75 on a present for his sister. If he had $183.89 left over, how much did he have to
begin with?

Answers

Okay so basically you need to see what half of the amount he started with was to do that you need to add both of the numbers ^^^ = 206.64. Which is half of the starting number so you times by two. =$413.28

How do you prove that lines are similar in triangles if it is parallel? (look at photo)

Answers

Answer:

they are similar cuz it resembles a "z" pattern. The angles are so the same.

Explain fully, please

Answers

Answer:

Step-by-step explanation:

formula of volume of cone is given so u simply substitute the values given and calculate.

Work is done for u .

Hope this helps u

What is the median of this set of data?

362, 187, 211, 298, 331, 250, 347, 199

Answers

Answer:

187, 199, 211, 250, 298, 331, 347, 362

[tex]median = {( \frac{n}{2} + 1) }^{th} \: value \\ = ( \frac{8}{2} + 1) {}^{th} \: value \\ = {5}^{th} \: value \\ median = 298[/tex]

Answer:

The median is the middle number in a set of data when the data is arranged in ascending (this is more common) or descending order. If there are an even number of values in the data set, the median is the arithmetic mean of the two middle numbers. Thus, the median separates the lower and higher half of a data set.

Step-by-step explanation:

ascending order : 187, 199, 211, 250, 298, 331, 347, 362

answer: 250, 298 .

Find the circumference of the circle.​

Answers

Answer:

37.68 is the correct answer

Step-by-step explanation:

diameter of the given circle is 12ft

circumference of a circle = pi x diameter.

= 3.14 x 12 ft

= 37.68 ft

Answer:

A

Step-by-step explanation:

because use the equation circumference of a circle

[tex]2 \times \pi \times r[/tex]

so 12 is diameter half it will be 6 which is radius. Then insert the number in the equation. hope this helps:)

Triangle MNO has vertices M(6,5), N(2,2), and O(7,0). It's image has vertices M'(-6,5), N'(-2,2), and
O'(-7,0). Which line of reflection maps triangle MNO onto its image?
x = 1
y=1
x = 0
.y=0

Answers

Answer:

x=0

Step-by-step explanation:

because the y values are not changing and the x values are only changing from positive to negative.

math. please help..with working ​

Answers

Answer:

[tex]\text{(C) }300\pi\:\mathrm{cm^3}[/tex]

Step-by-step explanation:

The volume of a cylinder with radius [tex]r[/tex] and height [tex]h[/tex] is given by [tex]V=r^2\pi \cdot h[/tex].

What we're given:

[tex]r[/tex] of 5 cm[tex]h[/tex] of 12 cm

Substituting given values, we get:

[tex]V=5^2\pi \cdot 12 =\boxed{300\pi\:\mathrm{cm^3}}[/tex]

Answer:

c

Step-by-step explanation:

The formula for the volume of a cylinder is [tex]V=\pi r^2h[/tex]

We know r is 5, and h is 12.

Then we can just plug the values into the formula.

[tex]V=\pi (5)^2(12)\\ V=\pi (25)(12)\\\V=\pi (300)[/tex]

So the answer is c, 300pi

Determine the value of”k” when the lines y=k/3x+2 and y=1/4x+2 are perpendicular.

Answers

Answer:

k = -12

Step-by-step explanation:

When lines are perpendicular, their slopes are the opposite reciprocal of each other.

The opposite reciprocal of [tex]\frac{1}{4}[/tex] is -4

[tex]\frac{k}{3}=-4[/tex]

k = -12

If I roll 3 Dice .. What is the probability that I roll, a Even Number, and Odd Number, and a number bigger than 3. (P even, odd and >3)

Answers

The probability of rolling an even number, odd number and a number bigger than three is ½ or 50%.

what is the correct answer​

Answers

Answer:

Step-by-step explanation:

B is correct answer

The correct answer is B

(HELP) A glass jar contains 5 red, 7 green, 9 blue and 11 yellow marbles. If a single marble is picked at random from the jar, what is the probability of it being a blue marble? *

1/11
5/18
9/32
5/12

Answers

Answer:

Find the volume of this prism.

13 1 point
Determine if the two triangles are congruent. If they are, state how you know.
A) Not enough information
C) SSS
B) SAS
D) AAS

Answers

the SAS is a special forces Unit let's goo

Sum1 plz help with this

Answers

Answer:

ur answer is 8.06

Step-by-step explanation:

a² + b²= c²

4² + 7² = c²

16 + 49 = c²

65 sooo u do √65= 8.06

Solve -7u = -21 for u. u =

Answers

Answer: u = 3

Step-by-step explanation:

Divide each side by -7 to get u = 3.

Answer:

3

Step-by-step explanation:

-7u = -21

To solve the problem we need to isolate u. Since -7 is being multiplied by u, we could divide to get rid of it.

-7u

[tex] \frac{ - 7u}{ - 7} = - 21 \div - 7[/tex]

u= -21/-7

u = 3

1. If one leg gets longer the other leg must also
get longer in order to keep the hypotenuse the
same.
TRUE
FALSE

Answers

False because is not the same and it doesn’t make sense

Find the radius y of circle C, given that x = 12 and z = y + 8.
PLEASEEE HELP ME

Answers

i think the answer is 3 :))

The radius of the given circle is 5, option C is correct.

What is Trigonometry?

Trigonometry is a branch of mathematics that studies relationships between side lengths and angles of triangles.

In the given figure, y is the radius.

By pythagoras theorem we find the radius

In a right-angled triangle, the square of the hypotenuse side is equal to the sum of squares of the other two sides.

AC²+AB²=BC²

y²+12²=(y+8)²

y²+12²=y²+64+16y

144=16y+64

Subtract 64 from both sides

144-64 = 16y

80=16y

Divide both sides by 16

y=5

Hence, the radius of the given circle is 5, option C is correct.

To learn more on trigonometry click:

https://brainly.com/question/25122835

#SPJ2

What is the remainder when 4x^3+8x-32 is divided by x+10?

Answers

Answer:

The remainder is -4112.

Step-by-step explanation:

We can use the Polynomial Remainder Theorem. According to the PRT, when we divide a polynomial P(x) by a binomial in the form of (x - a), then the remainder will be P(a).

We are dividing:

[tex](4x^3+8x-32)\text{ by } (x+10)[/tex]

We can rewrite the divisor as:

[tex]x+10=x-(-10)[/tex]

So, a = -10.

Then according to the PRT, the remainder of the operation will be:

[tex]R=P(-10)=4(-10)^3+8(-10)-32=-4112[/tex]

a/2-8=-4
I have no idea how to do this!!

Answers

Answer:

a = 8

Step-by-step explanation:

a ÷ 2 - 8 + 8 = - 4 + 8

a ÷ 2 = 4

a ÷ 2 × 2 = 4 × 2

a = 8

Answer:

a = 8

Step-by-step explanation:

Given

[tex]\frac{a}{2}[/tex] - 8 = - 4 ( add 8 to both sides )

[tex]\frac{a}{2}[/tex] = 4 ( multiply both sides by 2 to clear the fraction )

a = 8

Identify the property being demonstrated for each expression.
13+ (5 + 7) = (3 + 5) + 7
(3)[5(7)] = (3)[7(5)
5 + 0 = 5

Answers

Answer:

3 + (5 + 7) = (3 + 5) + 7

Associative property

(3){5(7)} = (3){7(5)}

Commutative Property

5 + 0 = 5

Identity Property

Step-by-step explanation:

can someone please explain to me how to do this?

Answers

Answer:

The fourth coefficient is 4.

Step-by-step explanation:

Pascal's Triangle in this case has 5 rows of coefficients because the highest power in (y + w)^4 is 4.  4 plus 1 is 5.

     Here's the appropriate Pascal's Triangle:

     1

    1  1

   1  2  1

 1   3  3   1

1  4  6  4    1          Use this row when expanding the 4th power of (v + w).

Notice that in the given expansion, the coefficients are

1, 4, 6, 4  1

This corresponds to the last (5th) row of Pascal's Triangle (above).

So the correct coefficient to be placed in the box is 4.

Please help
Linear Pairs of Angles
Use the value of x to find the
measure of Angle 1.
X = 25
Z1 = [?]° Z2 = [ 1°
5x - 5 2x + 10
22=0

Answers

Answer:

5x-5

This equal : 120

2x+10

the second is 60

A camera and a case cost 100 dollars. If the camera cost 90 more dollars than the case. How much does the case cost.

Answers

Answer:

Cost of case = $5

Step-by-step explanation:

x = cost of camera and y = cost of case

x = y + 90

x + y = 100

y + 90 + y = 100

2y = 10

y = 5

x = y + 90

x = 5 + 90

x = 95

Therefore, the cost of the camera is $95 and the cost of the case is $5.

The cost of case is 5 dollars.

What is the equation?

The equation is the defined as mathematical statements that have a minimum of two terms containing variables or numbers is equal.

Let,

Cost of camera = a and

Cost of case = b

Given that, camera and a case cost 100 dollars

a + b = 100

Since, the camera cost 90 more dollars than the case

So, a = b + 90

Substitute the value in the equation a + b = 100

b + 90 + b = 100

2b = 10

Divided by 2 both the sides

b = 5

Substitute the value of b in equation

a = b+ 90

a = 5 + 90

a = 95

So, the cost of the camera is $95 and the cost of the case is $5.

Hence, the cost of the case is 5 dollars.

Learn more about equation here:

brainly.com/question/10413253

#SPJ2

Interest earned:$45 Principal: ? Interest rate: 3% Time: 2 years

Answers

Answer:

The Principal = $75,000

Step-by-step explanation:

Formula for finding the principal:

I × 100/ R × T

Therefore;

Principal = 45 × 100 / 3/ 100 × 2

[tex] = \: \frac{45 \times 100}{ \frac{3}{100} \times 2} \\ = \frac{4500}{ \frac{3}{50} } \\ = 4500 \times \frac{50}{3} \\ = 1500 \times 50 \\ = 75000.00[/tex]

Which means that the Principal is $75,000.00

State if triangles HAG and CAB are similar and why.

Answers

i think the answer is they are similar by SSS, but they are definitely similar

round to the nearest tenth for 69.08, 43.96, 39.564 please show how to do it ​

Answers

Answer:

69.08 ⇒ nearest tenth

To round 69.08 to the nearest tenth, 0 is in the tenths place and 8 is in the hundredths place.  Since the digit in the hundredths place (8) is greater than  5, add 1 to the digit in the tenths place (0).

1 + 0 = 1, so the digit in the tenths place becomes 1  & the digit in the hundredths place is dropped.

∴ 69.08 ≈ 69.1 (corrected to the nearest tenth)

43.96 ⇒ nearest tenth

To round 43.96 to the nearest tenth, 9 is in the tenths place and 6 is in the hundredths place.  Since the digit in the hundredths place (6) is more than 5, add 1 to the digit in the tenths place (9), add 1 to the digit in the tenths place (9). This will also add 1 to the whole number part and make the fractional part 0.

1 + 9 = 10

∴ 43.96 ≈ 44 (corrected to the nearest tenth)

39.564 ⇒ nearest tenth

To round 39.564 to the nearest tenth, 5 is in the tenths place and 6 is in the hundredths place.  Since the digit in the hundredths place (6) is more than 5, add 1 to the digit in the tenths place (5), add 1 to the digit in the tenths place (5).

1 + 5 = 6, so the digit in the tenths place becomes 6 & the digit in the hundredths and thousandths place is dropped.

∴ 39.564 ≈ 39.6 (corrected to the nearest tenth)

Rounding to the nearest tenth are:

69.08 rounded to the nearest tenth is 69.1.43.96 rounded to the nearest tenth is 44.0.39.564 rounded to the nearest tenth is 39.6.

Rounding to the nearest tenth means finding the nearest multiple of 0.1 or one decimal place.

To do this, examine the digit in the hundredth place and decide whether to round up or down based on that digit.

For 69.08, the digit in the hundredth place is 0.

Since 0 is less than 5 then round down, which means the digit in the tenths place remains the same.

Thus, 69.08 rounded to the nearest tenth is 69.1.

For 43.96, the digit in the hundredth place is 9.

Since 9 is greater than or equal to 5, increasing the digit in the tenths place by 1.

Therefore, 43.96 rounded to the nearest tenth is 44.0.

For 39.564, the digit in the hundredth place is 5.

Since 5 is exactly halfway between 0 and 10, round to the nearest even number.

Thus, 39.564 rounded to the nearest tenth is 39.6.

Learn more about Rounding off here:

https://brainly.com/question/28128444

#SPJ6

Find m∠ABC.




132°


48°


19°


21°

Answers

Answer:

Step-by-step explanation:

48

Find the gradient of the line segment between the points (-5,2) and (4,3) give your answer in the simplest form

Answers

Answer: The gradient of the line segment between the points (-5,2) and (4,3) is [tex]\dfrac{1}{9}[/tex].

Step-by-step explanation:

Formula for gradient of a line segment :

[tex]\text{Gradient}=\dfrac{\text{Difference between y-coordinates}}{\text{Difference between x-coordinates}}[/tex]

Given points of the line segment: (-5,2) and (4,3)

[tex]\text{Gradient} =\dfrac{3-2}{4-(-5)}[/tex]

[tex]\text{Gradient} =\dfrac{1}{4+5)}[/tex]

[tex]\text{Gradient} =\dfrac{1}{9}[/tex]

Therefore , the gradient of the line segment between the points (-5,2) and (4,3) is [tex]\dfrac{1}{9}[/tex].

I’m stuck on this question plz help

Answers

Answer:

3(n-8)

Step-by-step explanation:

Does f(x) = - 3x² + 6x - 4 have a maximum or
minimum? Find the value

Answers

Answer:

Maximum value.

it = -1.

Step-by-step explanation:

Maximum value as the coefficient of x^2  is negative.

To find this value we convert to vertex form:

y = -3x^2 + 6x - 4

y = -3(x^2 - 2x) - 4

y = -3[(x - 1)^2 - 1] - 4

y = -3(x - 1)^2 + 3 - 4

y = =3(x - 1)^2 - 1

Minimum value = -1.

Other Questions
29 members in math club, treasury has $364 to spend, shirts are $11 caps are $14. How many caps and shirts can he buy to exhaust the funds available? Otto invests $ 600 in an account that pays 7.3 % interest compounded annually. How much is in Otto's account after 3 years Consider Hermia's first words when she enters the scene. How do her comments about the setting relate to the action of the scene? In particular, how might Shakespeare intend a double meaning here for her use of the word "sense"? A woman sold an article for 20.00cedis and made a profit of 25%.Find the cost price of the article. What is the sign of -9. (0/-3) Lighting is the movement of? What is 100 5 4 + 43 A. 69B. 144C. 0.3D. 1.2 From the top of the leaning tower of Pisa, a steel ball is thrown vertically downwards with a speed of 3.00 m/s. if the height of the tower is 200 m, how long will it take for the ball to hit the ground? Ignore air resistance. Suppose that the speeds of cars travelling on California freeways are normally distributed with a mean of miles/hour. The highway patrol's policy is to issue tickets for cars with speeds exceeding miles/hour. The records show that exactly of the speeds exceed this limit. Find the standard deviation of the speeds of cars travelling on California freeways. Carry your intermediate computations to at least four decimal places. Round your answer to at least one decimal place. Express this sense sequence as a polypeptide. Use the three letter abbreviation and separate the amino acids with a dash - e.g. Trp-Thr-Ala. If there is a stop codon - you may add an asterisk to the sequence - e.g. Trp-Thr-Ala-* ATTTTAGCCATGCCCGGGAAAATACGCCGCCCTCCCGGTACACCATTGTTCGGCAAATAAAAATAAAAT polypeptide sequence [answer1] what is the DNA sequence of the 5' UTR? [answer2] what is the RNA sequence of the 3' UTR [answer3] Please help!!!hi,can you please help me with this?thanks can someone answer this please What is the reporters motive in article 1?What is the reporters motive in article 2?Which term from Senator Nelsons quote in article 2 is an example of bias? Help Me please!!!!! Rn calculate the mass in 4.05*10^22 molecules of calcium phosphate Which event is inferred by most scientists to be responsible for a climate change that has recently led to a decrease in the size of most glaciers? * a decrease in the rate of divergence of lithospheric plates along a mid-ocean ridge O a decrease in the amount of insolation reaching Earth's surface an increase in the amount of greenhouse gases in Earth's atmosphere an increase in the amount of vegetative cover in the tropics How is an ammeter connected in a circuit to measure current flowing through it? A skier of weight 700 N is pointed down a ski hill that has a slope angle of 25 above horizontal.What is the component of his weight pulling him down the slope.O 634NO 326NO 296NO 700N The following is a comprehensive problem which encompasses all of the elements learned in previous chapters. You can refer to the objectives for each chapter covered as a review of the concepts.Note: You must complete part 1 before completing part 2.Based on the following data, prepare a bank reconciliation for December of the current year:a. Balance according to the bank statement at December 31, $283,000.b. Balance according to the ledger at December 31, $245,410.c. Checks outstanding at December 31, $68,540.d. Deposit in transit, not recorded by bank, $29,500.e. Bank debit memo for service charges, $750.f. A check for $12,700 in payment of an invoice was incorrectly recorded in the accounts as $12,000.Enter all amounts as positive numbers.Kornett CompanyBank ReconciliationDecember 31, 2014SubtotalAdjusted BalanceDeductAdjusted Balance Simplify (2x^2 + 4x) - (7x - 3x^2 + 5)