Write the complementary sequence to the following DNA strand: CGCCTTACTATG​

Answers

Answer 1
Answer: GCGGAATGATAC

Explanation: C goes with G (and vice versa)
A goes with T (and vice versa)

Related Questions

Birds can regulate their body temperature, they are

(A) ectothermic

(B) endothermic

(C) mesleothermic

(D) hydroponic

Answers

Answer:

b

Explanation:

Birds are Endotherms since they generate more heat to control their body temperature and so unlike ectotherms, bird's regulating of body temperature is based on internal rather than external(environmental) factors.

Describe natural selection

Answers

Answer:

Natural selection is the differential survival and reproduction of individuals due to differences in phenotype. It is a key mechanism of evolution, the change in the heritable traits characteristic of a population over generations.

Explanation:

best suited to the situation survive, and the ones that aren’t die

The image shows groundwater zones.

Top to bottom: Porous rock or soil, Water, Impermeable rock. Zone 1 is at the top of porous rock. Zone 2 is between porous rock and water. Zone 3 is in the Water. Zone 4 is between the Water and Impermeable rock.

Which is the saturated zone?

1
2
3
4

Answers

Answer:

The answer is 3

Explanation:

Hope this helps

Answer:3 or c

Explanation:

why would wearing sunscreen help prevent melanoma

Answers

Answer:

Sunscreen reduces the level of UV radiation, which causes damage to DNA, and slows the development of melanoma

After applying sunscreen to the skin of the mice, the team found it significantly reduced the level of DNA damage caused by UV radiation, which slowed development of melanoma

PLS HELP ME!!!!!!!!!!!

Answers

Answer:

From the mouse

Explanation:

It is directly gaining energy from the mous because the mouse is what gives the snake energy and if the snake directly consume it, it will get energy from it.

A 30 kg object has 3 forces acting on it - one 40 N force to the right, one 20 N force to the right, and one 30 N force to the left. What is the acceleration of the object?

A. 1.0 m/s2 to the right
B. 0 m/s2
C. 1.6 m/s2 to the right
D. 3 m/s2 to the left

Answers

Answer:

Thats not biology , that's physics . Net force = F1+F2-F3=40+20-30=60-30=30

F=ma.

30=30a

a=30/30

a=1m/s^2

What percentage of Japan’s population is between the ages of 0–4 years?

Answers

Answer:

looks like about 8% to me

40 to 44 percent of people are in the range of 0 to 4 years.

What is the population?

A population is a group of different people. There are three different types of population such as rapid growth, slow growth, and negative growth.

In rapid growth, the population will grow rapidly. While slow growth population grows very slowly. In negative growth population growth is negative.

In the population graph, male and female growth is shown. The darker color in the population shows males and the lighter color shows females population.

Therefore, 40 to 44 percent of people are in the range of 0 to 4 years.

To learn more about the population, refer to the link:

https://brainly.com/question/27991860

#SPJ2

b. Why is it possible to move the object that way?

Answers

there’s is no question there’s only an answer there’s nothing to explain

Answer: Because force gives an object energy to move in a certain direction. The distance that object travels all depends on the amount of force used and the amount of friction the object intakes.


Is the below sequence DNA or RNA? How do you know?
GTTTACAGGCGGCGCAATATCTGATCG

Answers

The answer is DNA I know because I know

Answer: DNA

Explanation: DNA has Thymine, Guanine, Cytosine, and Adenine.

RNA has all of those except for adenine which is replaced with Uracil.

In ancient times, why would a cloudy day make it so hard to tell what time it is?

Answers

Answer:

Because celestial bodies such as the sun and stars were used to tell time, so if they were obstructed by clouds it would be hard to tell time

In a certain state, electricity is generated by using the earths heat. Wells drilled and natural steam is taken out through pipes. This natural steam powers the generator and the electricity generated. What type of energy is being used and what type of power plants are set up for harnessing this renewable energy?

Answers

Answer:

Geothermal

Explanation:

The geothermal energy is generated by the Earth's core that is a region with extremely high temperatures. The heat makes the geothermal power plants to work and thus generate energy from it.

Which is the best evidence that two species have a common ancestor?

A:The two species have the same diet.



B:The two species live in the same habitat.



C:The two species' skeletal structures are 90% identical.



D:The two species' DNA sequences are 90% identical.

Answers

Answer:

I'd go with D.

Explanation:

Species may share similar physical features because the feature was present in a common ancestor (homologous structures). Molecular biology. DNA and the genetic code reflect the shared ancestry of life. DNA comparisons can show how related species are.

The answer should be D

1. Summarize the scientific information that leads to conservation in each of the articles.
2. What social issues affected the problem or its solution in each of the stories?
3. How did economics delay scientists' first attempts for conservation in each story?
4. Describe the political actions that led to successful conservation in both stories.

Answers

Answer:

Explanation:

BY USING FOREST WISELY;

It was learnt that people are cutting trees at an worrying rate.This problem is disturbing because ;

1)Those trees are responsible for releasing of oxygen and they made up at least a quarter of the world population.

2) Those trees of the world make up of portion land species by more than forth or fifth portion.

There are also economic implications as a result of trees been cut down, when there is no availability bot trees , it could result to situation whereby there would be scarce of resources for industries as well as

hike price of paper in market, regardless of this trees are needed for manufacturing of important materials such as usage in making houses and others developments or growth

Therefore, all the afformentioned economic concern result in economics delay scientists' first attempts.

COMMUNITY CONSERVATION;

It was learnt that there is to the forest that those gorilla habitated, those human being that reside in those region reside there so they can practice their farming because their is available land there. They also reside there because of housing.

These gorillas were affected as a result of the destruction made to their habitat as well as the activities of the poachers that hunt them for production of the and skin.

There are adverse effect of the obliteration of the gorilla from on the society, it can result to having reduction in tourism in country such as

Uganda as well as Rwanda, as result of this the means of livelihood of people in that part could be affected because there would be Reduction in profit making. Hence the reason behind the increase in number gorillas in the region, because they know they know that those gorilla influence the number of tourist that comes there and the revenue that is generated through this tourism.

The article 'By using Forest Wisely' can be summarised as:

People are cutting trees at the wrong rate and trees play a crucial role in an ecosystem.

The trees produce oxygen and they made up at least a quarter of the world population.

The trees occupy the fourth or fifth portion of the land organisms.

In the absence of trees, the ecosystem will fail and the organisms dependent on them will eventually die.

The resources available from the trees will be scarce and the factories and industries that are dependent on trees will no longer be available.

Trees are required for manufacturing important materials.

The article 'Community Conservation' can be summarised as:

In the article, it was mentioned that the human populace urbanized the land region where gorillas were habituating.

The humans occupied the space to practice farming and make houses.

The population of the gorillas was disturbed and diminished.

The hunting of gorillas by poachers was also reduced.

The people of Uganda and Rwanda also suffered reduction tourism and conservation of wildlife.

Gorillas influence the number of tourists, therefore, the destruction of their habitats led to a reduction in profit-making.

Therefore, all the mentioned economic concerns result in economics delaying scientists' first attempts.

To know more about forest conservation, refer to the following link:

https://brainly.com/question/16505239

Which of the following delivers oxygen to the body?
Mark all that apply
Arteries
Veins
Capillaries
Hemoglobin

Answers

I think arteries, capillaries, and hemoglobin delivers oxygen to the body. So all except veins because veins carry blood to the heart, not the body.

El aparato respiratorio presenta unas células productoras de ... Que atrapan los gérmenes y el polvo. En su superficie tienen una gran cantidad de unas estructuras celulares llamadas ... Cuya función es extender el mucus y dirigirlo hacia el exterior. En el estómago, las glándulas digestivas producen el ... El cual, por su extremada ... Ataca y destruye a los ... Que se introducen con la comida y la bebida.

Answers

Answer:

The respiratory system has cells that produce MOCO OR MUCUS, which trap germs and dust. On their surface they have a large number of cellular structures called CILIAS, whose function is to spread mucus and direct it outwards. In the stomach, the digestive glands produce the STOMACH ACID, which, due to its extreme ACIDITY, attacks and destroys the PATHOGEN MICROORGANISMS that are introduced with food and drink.

Explanation:

In the respiratory and digestive apparatus there are two types of super specialized mucous upholstery, where the cellular world is challenged.

In the respiratory mucosa the production of mucus and the mobilization of the cilia are part of the innate response of the organism as well as the acidity that is generated in the upholstery and in the gastric tract.

Biogeochemical cycles _______.

Answers

Answer:a biogeochemical cycle or substance turnover or cycling of substances is a pathway by which a chemical substance moves through biotic (biosphere) and abiotic (lithosphere, atmosphere, and hydrosphere) compartments of Earth.

Explanation:

A biogeochemical cycle is one of several natural cycles, in which conserved matter moves through the biotic and abiotic parts of an ecosystem

Please help out! It would be very nice !!

Answers

Answer:D

Explanation:

Cell wall provides structure and protection

Answer:

D is the answer to the question

Drag each description to the correct type of succession.

vacant parking lot for many years

Primary succession

Secondary succession

abandoned baseball field

recently cooled lava field

rocky hill under a melted glacier

clear-cut forest

1) Intro

Done

ivity

Answers

Answer:

1) vacant parking lot for many years (secondary succession)

2) abandoned baseball field (secondary succession)

3) recently cooled lava field (primary succession)

4) rocky hill under a melted glacier (primary succession)

5) clear-cut forest (secondary succession)

Explanation:

Succession in ecology is the gradual encroachment of life on a given ecosystem.

Primary succession involve a new never-before colonized region like a new lava deposit or land hidden under glacial sheets. Secondary succession is the encroachment of life on an area formerly harboring life but had experience a disturbance like wildfire, agricultural activities, logging etc.

Answer:

PRIMARY SUCCESSION (recently cooled lava field) and (rocky hill under a melted glacier). SECONDARY SUCCESSION (vacant parking lot for many years) (abandoned baseball field) and (clear-cut forest.

Explanation:

it's correct

. Why is the carpel considered female and the stamen male?​

Answers

Answer:  A carpel is the female reproductive part of the flower, interpreted as modified leaves that bear structures called ovules, inside which the egg cells ultimately form and composed of ovary, style and stigma. Stamen, the male reproductive part of a flower, consisting of a long slender stalk and the pollen-producing anther.

Explanation:

Approximately how many elements are there that combine chemically in a great number of ways to produce compounds?A.25B.50C.75D.100 plssss help meee

Answers

Answer:

D.100

Explanation:

There are A lot so 100 is the most.

Answer:

The structures of chemical compounds are influenced by complex factors, such as bond angles and bond length.All the matter in the universe is composed of the atoms of more than 100 different chemical elements, which are found both in pure form and combined in chemical compounds.

A formula shows the types of elements present and the proportion of each element ... microbe or a multicellular animal or plant, can be compared with a chemical factory. ... In many living organisms, the elements carbon, hydrogen, and oxygen are ... The various elements can combine to form a great number of compounds.

Explanation:

Atoms are the smallest particles of matter that can enter into chemical reactions. ... The mass number of the most abundant isotope of any element is determined by ... Compounds with a significant percent of polar covalent bonds are called polar ... Fatty acids are organic acids that have very long hydrocarbon chains making. HOPE THIS HELPS!!

Glaciers pushing rocks against rocks is an example of

Answers

Answer:

Erosion??

Explanation:

Answer:

Glacial Erosion

Explanation:


The landform pictured above is _____, which has formed out of _____ and _____.
O A. a glacier, snow; ice
B. a glacier; ocean water, snow
O C. a mountain; snow; ice
OD. an iceberg; ocean water, snow

Answers

Answer: a glacier; snow; ice

Explanation:

Just did it and it was right

BRAINLIEST!!!
What cells are used after injecting a vaccine that help us to not get sick?

Answers

Answer:

answer should be antibodies!

Explanation:

hope this helps <3

Tracey was learning about structural organization in animals. What level of structural
organization BEST describes an egg?
A. a cell
B. a tissue
C. a system
D. an organ​

Answers

Answer:

A

Explanation:

Egg cell

The level of structural organization which best describes an egg is: A. a cell.

A cell can be defined as the fundamental (basic) structural, functional, and smallest unit of life, that is typically found in all living organisms such as animals.

The structure of an egg is similar to those of cells found in living organism, which are structurally layered with various cell organelles.

An egg shell is selectively permeable because it acts as an outer membrane just like in living cells to prevent unwanted materials from going into the egg.

In conclusion, the level of structural organization in animals cells can best be describe by using an egg.

Read more: https://brainly.com/question/19559847

Please help me, thank you!​

Answers

Gene: is a unit of heredity which is transferred from a parent to offspring and is held to determine some characteristic of the offspring. An example is hair or eye color

Allele: is different forms of a gene. An example would be how tall or short.

Homozygous: is two alleles that are the same trait. An example would be two alleles for straight hair.

Heterozygous: is two different traits like one for staright and one for curly hair.

Dominant: is the stronger form of an allele. Like the grey fur is the stronger one

Recessive: is the weaker form of an allele. Like white hair is the least likely.

Pheneotype: is the physical apperance.

Genotype is the genetic makeup of an organism.

The Seven Sisters are seven stars located more than 400 light-years away in the Taurus constellation and they can be seen here with Venus and another constellation, Orion. Why do these stars seem so small compared to our Sun, also a star?
A) Our Sun is much larger than any of the Seven Sisters.
B) Our Sun is much closer to Earth than the Seven Sisters.
C) The Seven Sisters are ancient stars; the Sun is a young star.
D) Stars found in constellations are much older and smaller than any other stars.

Answers

Answer:

The reason why these stars seem so small compared to our Sun is:

B) Our Sun is much closer to Earth than the Seven Sisters.

Explanation:

The reason behind this is that the sun is at a distance of the earth of 0.000016004 light-years. While the seven stars are at a distance of 400 light-years. Making them so far away that their size is reduced because in physics object size is altered by the perspective of the watcher or observer. Meaning that a ball the size of a car can be seen by our eyes as small as a bean if it is at the proper distance.

What is the product of the cellular respiration reaction A. Glucose B.carbon dioxide C.blood D. Cells

Answers

Answer:

B.

Explanation:

You inhale oxygen and release it as C02.

Answer:

glucose

Explanation:

most of the reaction comes from the mitochondria which produces glucose for the cells.

In organ transplants, the body recognizes that the new organ is made of foreign cells. What kind of medicine would you give a patient to increase the chances of transplant success?

Answers

Answer:

immunosuppressant

Explanation:

After an organ transplant, you will need to take immunosuppressant (anti-rejection) drugs. These drugs help prevent your immune system from attacking ("rejecting") the donor organ. Typically, they must be taken for the lifetime of your transplanted organ.

All cells reproduce to make new cells. However, stem cells actually form many different types of cells. Adult stem cells can also repair tissues in the body.

Which action would be completed by skeletal muscle tissue 1.moving blood
2.increasing the heartbeat, or 3. kicking a soccer ball

Answers

Answer:

Kicking a soccer ball

Explanation:

Answer:

Kicking a soccer ball

Explanation:because moving blood and having a heartbeat arent in need of a skeletal system

how did darwin’s theory of evolution change the way biologists thought about classification categories

Answers

Answer:

hhh3h3h3hgegegegegeggegsgsggs

y

Explanation:

hhhhhhshshshshhdhdhdhghdhgd

Because at the time they classify by if it fly,swims,run etc but after Darwin’s theory it was study that animals evolve depending on the area
Other Questions
Which pattern of evolution is seen in the relationship between algae and coral?coevolutionadaptive radiationreproductive isolationconvergent evolution A cone has a height of 7 ft and a radius of 4 ft. Which equation can find the volume of the cone?v=5x(72)(4) 4v-}*(417)V = 38(72)(4) ftV = 3x(42)(7) You can use this area to create your resume. Whats the correct answer for this? A University of Florida economist conducted a study of Virginia elementary school lunch menus. During the state-mandated testing period, school lunches averaged 863 calories. The economist claims that after the testing period ends, the average caloric content of Virginia School lunches drops significantly. Set up the null and alternative hypotheses to test the economists claim. Three black beads, two red beads, and a yellow bead are arranged in a line. What is the probability that no black bead is adjacent to the yellow bead? Please Help with theses 3 questions. Extra points and brainiest will be given!!!!l Select the item that is not an element of Greek tragedy. CatharsisPlot Reversal Flawed Hero Rhyme Scheme last month he sold 50 chickens and 30 ducks for $550. this month he sold 44 chickens and 36 ducks for $532. how much does a chicken cost and how much does a duck cost ? ASAP!!consider the diagram below.which of the following is the value of x? a- 2b- 11c- 20d- 29 please ASAP , giving BRAINLIEST if correct. Find the supplement of an angle that measures 20 degrees.A)50 degreesB)70 degreesC)90 degreesD)160 degrees All of the following are true about gesture drawings EXCEPT which one ?A. They establish facial details of the character.B. They establish exaggeration.C. They establish movement of the character.D. They establish the pose of the character. Antonio has a CD-player that holds six CDs. He puts six different CDs in the player and the CD player randomly plays a song from any of the CDs. What is the probability that the CD player will play the first song from the first CD and the first song from the sixth CD? Write your answer as a fraction. Select the correct symbol to compare the rates.22 miles in 20 minutes 38 miles in 30 minutes list all the factor means use divisibility rules of 102,232 9 x minus 10 = 3 x + 2 En un proceso isobrico, la presin del gas es de 105 Pa. Halle el desplazamiento del pistn, cuya rea es de 0,4 m2, cuando el gas desarrolla un trabajo de 8 x 104 J Which of the following statements is true about media today?People can access the news via various methods.It has little impact on our society today.The media is heavily censored in the United States.Newspapers are obsolete, nobody reads them anymore.pls help asp 2 rectangular prisms. One prism has a length of 6 meters, width of 5 meters, and height of 5 meters. The other prism has a length of 4 meters, width of 5 meters, and height of 7 meters.What is the volume of the figure?116 m3190 m3290 m3390 m3