Would you expect the stomata of a desert cactus or the stomata of a water lily plant to close during the day?

Answers

Answer 1
A water lily will have more stomata. A desert cactus will have very few stomata, because in deserts plants face water shortage so in order to avoid loss of water cacti have adapted to the desert environment by possessing few stomata.
Answer 2

The stomata of a desert cactus will close during the day.

STOMATA:

The stomata (singular- stoma) are structures on the leaves of a plant that helps in gaseous exchange i.e. entry and exit of CO2 and O2 gases.

The stomata, however, when opened allows the passage of water vapor from the plant. Hence, plants utilize the opening and closing of stomata to regulate water loss.

Desert cactus is a xerophytic plant meaning that they can survive in low water conditions. One way they adapt to their desert environment, which is characterized by low humidity, is by the closure of their stomata during the day.

Therefore, the stomata of a desert cactus will close during the day.

Learn more at: https://brainly.com/question/3387375?referrer=searchResults


Related Questions

Inherited used in a sentence

Answers

I inherited my parents genes.

what is meant my urbanization and industrialization? How they degrade the environment ​

Answers

Urbanization is defined as “the process of making an area more urban” or an increase in the amount of people living in towns or cities. Industrialization is defined as “the development of industries in a country or region on a wide scale” meaning a strong military with modern weapons, factories to create things, modern cars and boats etc. Urbanization and industrialization put a strain on the environment because of carbon gases emitted, effectively warming the earth up, destruction of trees which lowers our overall oxygen available, destruction of animal homes which will kill animals or cause unwanted interactions between humans and animals, and the pollution of natural resources such as local ponds, streams or the ocean.

HELPPPPPP MEEEEEEEEE PLZZZZZZZZZZ

Answers

Answer:

01). cells

02).seeing inside the cells

03).Robert hook

7. B=brown eyes
b= blue eyes
What is true about these two brothers that have brown eyes:
One has genotype BB the other Bb.
a. they have same phenotype and genotype
b. they have different genotypes and phenotypes
c. they have same phenotype but different genotypes
d. they have same genotype but different phenotypes

Answers

C definitely c hope this helps

The truth about these two brothers that have brown eyes is they have the same phenotype (Brown) but different genotypes (BB and Bb). So, the correct option is C.

What do you mean by Genotypes?

Genotypes may be defined as a given set of alleles that an individual possesses. They are ultimate combinations of alleles.

In this situation, the allele B is dominant over the allele b, therefore, in both cases, phenotypes remain the same i.e. Brown eyes, but the genotypes differ. This defines how an allele interacts with another allele and changes the genotype.

Therefore, the truth about these two brothers that have brown eyes is they have the same phenotype (Brown) but different genotypes (BB and Bb).

To learn more about Gene interaction, refer to the link:

https://brainly.com/question/25217589

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

Which of these describes a way in which humans could increase biodiversity in a marine ecosystem? A. They could introduce new species to the ecosystem. B. They could limit fishing to only one kind of fish in the ecosystem. C. They could ban boating,snorkeling,and scuba diving in the ecosystem. D. They could restrict the amount of each type of fish or shellfish harvested from the ecosystem

Answers

I’m thinking D. But A also looks like it could be right

Developing a new vaccine takes about 5-10 years. So how is it possible to develope Corona vaccine so quickly?​

Answers

Answer:

vaccines were designed by using new technologies (i.e., RNA-based vaccines and adenovirus-based vaccines)

Explanation:

RNA-based vaccines are vaccines based on the delivery of specific messenger RNA (mRNA) sequences that are capable of encoding only one viral protein, thereby preventing the complete viral cycle/replication. Subsequently, this protein is recognized by the immune system that generates memory immunity by synthesizing specific antibodies against this protein (in this case, the spike S protein). On the other hand, adenovirus-based vaccines are vaccines designed by inserting a transgene cassette into an adenovirus which is used as vector to produce one specific viral protein inside the host. Like mRNA vaccines, this antigenic viral protein is then recognized by the immune system in order to produce antibodies against a defined protein epitope, thereby producing memory immunity.

How do adaptations lead to change?

Answers

In evolutionary theory, adaptation is the biological mechanism by which organisms adjust to new environments

How does the force of gravity move objects in the solar system?

Answers

Answer:

One of the most noticeable effects of gravity in the solar system is the orbit of the planets. The sun could hold 1.3 million Earths so its mass has a strong gravitational pull. When a planet tries to go past the sun at a high rate of speed, gravity grabs the planet and pulls it towards the sun

Explanation:

Which of the following solutions is neutral?


Group of answer choices


a solution with a pH of 14


a solution with a pH of 2


a solution with a pH of 7


a solution with a pH of 9


Flag this Question

Question 4

Potassium hydroxide has the chemical formula KOH. It feels slippery and is used in cleaning liquids. Based on this description, potassium hydroxide is most likely a(n)?


Group of answer choices


acid


base


neutral solution


pH indicator








first to answer gets the brinllest

Answers

Answer:

Kleenex

ekekkdkdkeeee

what RNA nitrogen bases match with the following DNA nitrogen bases?

Answers

While DNA has the ATCG nitrogenous bases, RNA replaces thymine with uracil, making its bases AUCG. So, that means that whenever DNA has adenine, instead of pairing this with thymine, RNA will use uracil instead.

what is a sedimentary rock

Answers

Answer:

Sedimentary rocks are formed from pre-existing rocks or pieces of once-living organisms. They form from deposits that accumulate on the Earth's surface. Sedimentary rocks often have distinctive layering or bedding. Sedimentary rocks are types of rock that are formed by the accumulation or deposition of mineral or organic particles at the Earth's surface, followed by cementation. Sedimentation is the collective name for processes that cause these particles to settle in place. Sedimentary rocks are made when sand, mud and pebbles get laid down in layers. Over time, these layers are squashed under more and more layers. Eventually, the layers are lithified – turned to rock. Sedimentary rocks can be formed in deserts, lakes, rivers and seas .

An example of __ is the color of betta fish. When a RED fish (GG) is crossed with a YELLOW fish (gg), all of the offspring will be a ORANGE color (Gg)

Answers

Answer:

The correct answer is  - incomplete dominance.

Explanation:

In the betta fish, there are different types of colors found in the fishes depends on the alleles present in their gene which follows incomplete dominance. Incomplete dominance is an inheritance pattern where a dominant allele does not mask completely and produce a blend of both alleles if present in heterozygous condition.

In the question, It is stated that when a cross between RED fish (GG) and a YELLOW fish (gg) produce orange color fish as offspring (Gg) which is a mix or blend of both alleles Red (dominant) and yellow (recessive).

Why is biodiversity important for ecosystems?

Answers

Answer:to stop from extinction

Explanation:

A frog that is dominant for its light green color mates with a brown frog and produces one small brown frog. How is this possible if the green color is dominate?

Answers

Answer:

The dominant (light green) parent was heterozygote for the trait

Explanation:

According to Gregor Mendel in his law of dominance, an allele is said to be DOMINANT if it masks the phenotypic expression of another allele in a gene. The allele being masked is called RECESSIVE allele. In this case of a frog whose allele for light green color is dominant over the allele for brown color, the light green color allele (G) is dominant while the brown color allele (g) is recessive.

However, in a cross between that have light green frog and a brown frog, a small brown frog is produced. This is possible despite the green color being dominant because the genotype of the light green dominant parent is HETEROZYGOUS i.e. it contains both light green (dominant) allele and brown (recessive) allele.

Hence, when a gamete with recessive allele (g) is produced by the heterozygous light green frog (Gg), it mates with a recessive allele from the brown frog (gg) to produce a brown offspring (gg).

A student placed a small chip of limestone into a hydrochloric acid solution, and carbon dioxide gas was released. The carbon dioxide provided evidence that
A. The formation of an element occurred.
B. Only a physical change occurred.
C. A chemical change occurred.
D. Only a loss of mass occurred.

Answers

C. A chemical change occurred.

Why are some theories more widely accepted than others such as the theory of evolution?

Answers

Answer:

Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.

Explanation:

I majored in Biology

write a short paragraph on hydra​

Answers

Answer:

at the moment i am thinking of 3 different hydra, marvel, mythical creature and creation on sexual reproduction between plants. If you could tell me the subject i could explain it to you. :)

Explanation:

Hydra are simple invertebrates, with two layers of body cells. They live in fresh water. Their body is radially symmetric. They have a central cavity through which they take in food and expel waste.

Select the letter of the correct answer.
Growers around the world produce about 3.2 x 107 metric tons of sunflowers each year. One
metric ton is the same as 1.1 short tons. How many short tons of sunflowers do worldwide
growers produce annually?

Answers

Answer:

3.5264 x [tex]10^{7}[/tex]

Explanation:

The metric ton is used as a unit of mass. The metric ton in British units can be represented as 2240 pounds or long ton whereas in United state is termed as 1.102 short ton.

In the given question, it has been mentioned that the growers around the world produce about 3.2 x [tex]10^{7}[/tex] a metric ton of sunflower.

So the short ton produced will be

= ( 3.2 x [tex]10^{7}[/tex] ) x 1.102

= 3.5264 x [tex]10^{7}[/tex] short ton.

Thus, 3.5264 x [tex]10^{7}[/tex] is the correct answer.

Which is required for sexual reproduction

Answers

Answer:

meiosis

Explanation:

meiosis is used to produce gametes for sexual reproduction

Answer:

Meiosis, and female and male

Explanation:

Sexual reproduction is a reproduction that requires a male and a female of the same species to contribute genetic material. Special cells called gametes are produced through meiosis, which halves the number of chromosomes in each resulting cell. These cells are called haploid gametes.

Fossil remains of Glossopteris (an extinct plant with large leaves) have been discovered in India and Australia. When they were living, all the Glossopteris were located together on land, but now the Glossopteris fossils are separated by an ocean. What could explain how these fossils got so far apart?

Answers

Answer:

Due to splitting of lands.

Explanation:

These Glossopteris fossils got so far apart from each other because of the splitting of super continent about 175 million years ago. Before 175 million years, India and Australia are attached to each other and these Glossopteris plants are present on these lands but with the passage of time, the lands of India and Australia split and go far away from each other so due to splitting of lands, these fossils got so far apart from each other.

Why is weather different from place to place?​

Answers

Answer:

There are differences in climate around the world because of differing amounts of radiation received from the Sun at different parts of the Earth at different times of the year.

Explanation:

Hope this helps :)

Answer:

because according to where they are located, atmosphere brings different weather and temperature, and some places are further away from the sun, just like when it is day in one side but night on the other

Explanation:

What is the function of a phospholipid bilayer

Answers

Answer:

Phospholipid bilayers create a selectively permeable barrier to the movement of ions and molecules important for cellular function.

Answer: The phospholipid bilayer acts as a barrier to the passage of molecules.

I need help with this (last question I had had the picture all black)

Answers

Answer:

I only know A

I think it's the lap

please HELP me i cant fail this class What are the two forces of gravity that contribute to tectonic plate movement at mid-ocean ridges?

Ridge subduction and slab flight


Ridge slip and slab slide


Ridge push and slab pull


Gravity does not pull them

Answers

Answer:

"Plate movement is thought to be driven by a combination of the motion of the seafloor away from the spreading ridge (due to variations in topography and density of the crust, which result in differences in gravitational forces) and drag, with downward suction, at the subduction zones."

Explanation:

Does this help?

It is because of ridge slip and slab slide i the divergent plate boundaries, where tectonic plates movement creates mid ocean ridges.

What is divergent boundary?

Divergent plate boundaries are the regions where the tectonic plates are diverging from one another, this is known as a divergent plate boundary. Above upward convection currents, this happens.

The lithosphere's base is pushed upward by the rising current, which lifts it off the ground and flows lateral currents beneath it. When an oceanic lithosphere border diverges, the rising convection current beneath raises the lithosphere, creating a mid-ocean ridge.

The plate material above is dragged along in the flow direction by this lateral flow. The overlaying plate is thinned out, fractures, and pulls apart at the peak of the uplift.

Hence, in fact it is not by the gravitational pull but by the ridge slip.

To find more on plate movement, refer here:

https://brainly.com/question/3970445

#SPJ6

Is sand called sand because its in between the sea and the land?
I'm asking the questions that need to be asked people! :'D

Answers

No, not at all. ... The English word 'sand' comes from Old Dutch/proto-German 'zand', which has nothing to do with either sea OR land, but referred originally to unstable ground, as near rivers.

I hate the English language sometimes, like: "waterfall". But anyways, I hope this helps ^^

Hmmm... I've never thought of that before... nice catch lol

Have a great day :D

The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.

What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?

An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.

Answers

The question to the above information is;

What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?

Answer;

An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.

Explanation;

-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.

J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:

atoms are spheres of positive chargeelectrons are dotted around inside

Answer:

Its C on edge

Explanation:

How many factors should a well-designed experiment test at one time?

Answers

Answer:

Depends on the number of experiment variables.

Explanation:

You should only test one variable/factor

list one part of the cell theory in your own words, explain what it means

Answers

One part of the cell theory is that pre-existing cells can form more cells

This means that cells that currently exist are capable of creating more cells, however it’s a slow process

Eukaryotic cells can be specialized for specific tasks in multicellular organisms

true
false

Answers

It is true from my looking
Other Questions
It takes 3 people to make one snowman. If there are 36 people, how many snowmen can bemade? Who were the first people to create the numbers The perimeter of the rectangle below is 42 inches. Find the value of x. 1. When the presidential election has a tie in the electoral college votes,who decides the winner? *1Vice President2House of Representatives3.Speaker of the House In A Raisin in the sun, how could you describe ruth and walters relationship at the beginning of the play? Which revision is needed to correct the following sentence?By sheer coincidence Maggie ran into her aunt and uncle, at thegrocery store.A. Move the comma to after the word and.B. Move the comma to after the word coincidence.C. Add a comma after the word Maggie.D. Add a comma after the word aunt. James and Noel sat on the steps of their new house. It was going to be a hot day, but the boys preferred sitting outside to unpacking more boxes inside. Their mom was unpacking kitchen stuff, and the boys had grown tired of hearing her exclaim every time she unwrapped another of the teapots she hadn't seen in months. "You'd think she'd have enough teapots by now," said James. "Yeah," said Noel, "I don't get that excited about my Godzilla collection and that is way more interesting than any teapot." "And I'm sorry," said James, "but I know way too much about teapots for a boy my age." James then started listing all the things he knew about teapots. "There's the spout and the pouring angle," he began. But Noel had already tuned James out. The heat was rising and as tired as he was of his mother's teapots, he was more tired of James' complaining. Besides, there was a raggedy old dog down the street. Noel could tell, even from far away, this was a dog that belonged to no one. Its coat was matted. It had no collar. All he could see of the dog's face was its nose sticking out. Its coat was all brown, but a dirty, grayish brown, not the deep dark warm brown that made you feel safe. "And there's that teapot with the flowers. The brown one with the little dots all in a row," James continued on his rant, now listing all the teapots he had unwrapped for Mom. Noel continued ignoring James and watched the dog. It was moving slowly in their general direction. It stopped at various spots along the curb to smell things. Sometimes the smelling took a very long time. Every now and then it would sit down to scratch behind its ear. Noel wondered if it was looking for something to eat. James jabbered on and Noel began to wonder how a dog came to be in such a sad condition as this one. Did no one ever want it? Even as a puppy, was this fellow not cute enough to find a good family? Had it always been this ugly? Hadn't anyone ever been kind to it? The dog was across the street now, one house over. It seemed to be particularly attracted to mailboxes and the plants around them. To Noel's mind, it appeared that the dog was greeting each family on the street. Noel watched the dog cross the street heading in their direction. He hadn't noticed it before, but the dog's head seemed rather large. It swung back and forth in front of its body, much like the bears Noel had seen at the zoo and on television. Noel could not see any eyes through all the matted hair. He could see gnats and flies hovering over the poor thing, waiting for it to sit down again. It lumbered toward them. Noel noticed that James had stopped talking. He looked over at his brother. Staring at the dog, James seemed to be a bit shocked or surprised, maybe even stunned. "What is that?" James whispered. Instead of sniffing their mailbox and moving on like before, the dog started up the sidewalk toward the steps where they were sitting. Noel could hear the flies buzzing and see not just a few gnats, but a whole swarm around the dog. Bits of leaves and twigs hung in its hair. The dog continued toward them. Was it going to stop, wondered Noel. Should I get up and get in the house? But then, just when Noel felt a twinge of panic, the dog sat down, wagged its tail, and smiled. Noel had never seen anything like it before. It was as if the dog, flies and all, were posing for a photographer. It is going to be an interesting summer, thought Noel.Read these lines from the text:Noel could not see any eyes through all the matted hair. He could see gnats and flies hovering over the poor thing, waiting for it to sit down again.These lines from the text tell us that (4 points) athe dog is probably a stray bthe dog has never had friends cthe dog must be dangerous dthe dog does not like people 9(-2,3)+ 88-12X(2.-1) Isabella deposited $2,000 in an account that earns 5% simple annual interest. After one year, how much interest will her investment earns? If a male organism has 40 chromosomes in each body cell, how many chromosomes does a female of the same sex have in each of her body cells? Please help ILL MARK U BRAINLIEST!! The cost of 5 pounds of bananas is $3.25. What is the constant of proportionality that relates the cost in dollars, y, to the numbers of pounds of bananas, x? According to the lesson, which of thefollowing is a type of promotion?Regular promotionActive promotionModified promotionReserve promotion How is gamma radiation produced? Please help me I will give you a Brainly A cone has a diameter labeled twelve centimeters and a height labeled thirty-two centimeters. Find the area of a vertical cross section through the center of the base of the cone. 4. On the island of Hawaii, Keanu notices that the sand on the beach is black, the same color as therock formations on the island. Keanu realizes the sand used to be part of the rock formations. Howdid material from the rock formations turn into sand? please just Write the answer of the questions BrainliestUse substitution to find the ordered pair of the following system of equations: y=6xy y=5x+7(_,_) 14.87+3.65ANSWER THE QUESTION HELPPPPPP PLSSSSSSSsssssssssssssssss