Why were Shakespeare’s plays so popular?

Answers

Answer 1
Shakespeare's plays are as popular as they are because he was perhaps the greatest writer who has ever lived. It's partly because he was writing plays which go on being performed and therefore which can be brought freshly to life for each generation by actors of the present.
By 1610, the actors were performing Shakespeare in German as his plays had become popular in Danzig. Some of Shakespeare's work was performed in continental Europe during the 17th century, but it was not until the mid 18th century that it became widely known.
Not only did Shakespeare teach us about ourselves and humanity, but he also invented around 1700 words which we still use in everyday English today. He often changed nouns into verbs, verbs into adjectives, connecting words together and coming up with wholly original ones too.
Answer 2
Shakespeare was one of the best writers in history and his plays were amazing because of the quality. The plays were played by brilliant actors and Shakespeare even credited the actors themselves and thanked most of his actors for the wonderful plays they performed. People in that era had never seen such brilliant plays and writing before so, hence they became popular.

Related Questions

Building off previous experiences, choose the traits that you feel are necessary to building healthy relationships

Answers

One of the most definite traits is honesty. But it would vary for everyone maybe some people would say cleanliness, organized, funny, kind, caring, the list goes on and on.

Use the words hostile and hospitable in a sentence

Answers

The words are the hostile and hospitable are:

The public were very kind-hearted and the hospitable.Tom was openly hostile towards her friends.

What is words?

The term words refer to the combination of the letters. The words are the always in to define the meaning. The letters are the arranged in proper manner of the spellings are the correct format. The words are the arranged in proper manner in the creation of the sentence. The words are the noun and the pronoun.

According to the given, the words are the described the hostile and the hospitable. The sentence formation was the making of the correct formation.

The public were very kind-hearted and the hospitable.Tom was openly hostile towards her friends.

Hence, the words are the aforementioned.

Learn more about on words, here:

https://brainly.com/question/28611

#SPJ2

Read this section from “Counterpoint: Mandatory Volunteer Work Does More Harm Than Good” from Should Volunteering Be Mandatory for Teens? and answer the follow-up questions.

The most compelling argument against making volunteer work a mandatory part of school curriculum is time. Teens today are just too busy to add another stressor to their lives. Let’s take a look at twenty-four hours in the life of a typical teen. Allocate eight hours per day for sleep, eight hours for school (including getting ready and travel time), three hours for homework, two hours for activities such as sports or a part-time job, two hours for dinner and family time, and one hour for socializing. These activities take up all twenty-four hours leaving scarcely any time for volunteer work. Should students have to sacrifice their one hour of socializing per day, or sacrifice an hour of precious family time? These options just don’t make sense as making more demands on teens’ packed schedules can have serious side effects. Teens who are too busy feel tired, anxious, or depressed. Studies show they often have headaches or stomachaches due to stress, missed meals, or lack of sleep and they may fall behind in school, causing their grades to suffer. These drawbacks clearly outweigh the benefits of volunteering.

What is the author’s point of view concerning teenagers and their time?

A. Teens spend time on frivolous things.

B. Teens need better time management skills.

C. Teens have little free time to spare.

D. Teens should have less stress in their lives.

Answers

Answer:

D i took the test hope this helps! :)))

pls mark brainlyest!

Answer:

I would say your best possible choice is D, seeing as the whole excerpt talks about how the busy lifes of teens puts alot of stress on themselves in more ways than one!

Explanation:

- Eijiro <3

(I love your pfp btw! :D)

When a company goes public, it begins doing what?

A.
Offering new products for sale

B.
Selling shares of stock

C.
Issuing government bonds

D.
Paying corporate income taxes

Answers

Answer:

selling shares of stock

Explanation:

which of the following angles would a director most likely use to film the weak underdog in a movie?

Answers

Answer:

High!

Explanation:

Answer:

High

Explanation:

Why did Maheo ask the animals for help?

Answers

Needed help with fixing them food

HELP
In addition to characters, symbols, and imagery, an author often uses _____ to communicate a theme.

a foil
denotative meaning
plot
point of view

Answers

Answer:

Plot

Explanation:

Plot is the entire structure and foundation of a story. Without plot, a theme is just an unrepresented idea.

t1ckl3s w00p

25 PNTS (WARNING, some reading required) -please be detailed if possible-

Drag the tiles to the correct boxes to complete the pairs. Not all tiles will be used.

Match each excerpt from Mark Twain's Adventures of Huckleberry Finn with the type of conflict it contains.

TILES
1: character versus self
2: character versus society
3: character versus nature
4: character versus character

AREAS TO DRAG TILES TO
A: Well, the days went along, and the river went down between its banks again; and about the first thing we done was to bait one of the big hooks with a skinned rabbit and set it and catch a catfish that was as big as a man, being six foot two inches long, and weighed over two hundred pounds. We couldn't handle him, of course; he would a flung us into Illinois.

B: It made me shiver. And I about made up my mind to pray, and see if I couldn’t try to quit being the kind of a boy I was and be better. So I kneeled down. But the words wouldn’t come. Why wouldn’t they? It warn’t no use to try and hide it from Him. Nor from ME, neither. I knowed very well why they wouldn’t come. It was because my heart warn’t right; it was because I warn’t square; it was because I was playing double. I was letting ON to give up sin, but away inside of me I was holding on to the biggest one of all.

C: By and by he rolled out and jumped up on his feet looking wild, and he see me and went for me. He chased me round and round the place with a clasp-knife, calling me the Angel of Death, and saying he would kill me, and then I couldn't come for him no more.

Answers

Answer:

Character vs. Self goes to B.

Character vs. Character goes to C.

Character vs. Nature goes to A.

Explanation:

I hope I helped!

Answer:

A=3 character vs nature, the conflict is with a fish which is a part of nature.

B=1 character vs self, the conflict is within him about his heart and his sins.

C=4 character vs character, the conflict is between to people having a fight.

Please help me this is due today and no file please
I need help explaining why it is logos

1.Seven out of ten people would recommend that you buy this video game and how do you know it is logos

Answers

Answer:

because it uses statistics and research from people to support the statement which is also a way to persuade the buyers to purchase the product.

Can I add pictures into these things for people to answer? Im lazy, no offense.

Answers

Answer:

Yes!

Explanation:

Read the paragraph below from the section "Key Ideas."

Lin's work is often called Minimalist, a style where abstract art is made out of simple shapes and clean lines. Previous minimalists, mostly male, did not deal directly with historical events as Lin did. It took most of the world some time to catch up to her ideas, which combined abstract art, nature, and human emotion.


What is one reason why the author includes this paragraph in the article?



A. to compare the benefits of minimalist art with those of more traditional art


B. to explain how Lin's work fit into the art world when she started


C. to describe a problem with Lin's style of art


D. to explain what motivated Lin to create art about historical events

Answers

Answer:

B

Explanation:

Interpret In lines 69-70 of the excerpt from The Prelude, what does the speaker mean when he says his heart "had been turned aside//From Nature's way"?

Answers

Answer:

With these lines, the narrator who says that he has become disoriented and does not know what to believe anymore.

Explanation:

When the narrator states that he has strayed from the path of nature, he is referring to nature itself, that is, he is referring to his own beliefs, opinions and convictions. This shows that the narrator went through a moment of so much disappointment that it left him confused, disoriented, unable to believe in his own reasoning and in what he felt was correct and appropriate. In other words, the narrator has lost his essence, his nature and does not know what else to do.

CAN SOMEONE PLEASE HELP ME

Answers

I think it’s B hope this helps !!
I Believe b is the correct answer!!

What type of figurative language is represented in the following quote?
"O God, I have an Ill-divining soul!
Methinks I see thee, now thou art so low,
As one dead in the bottom of a tomb."
A. foreshadowing
B. hyperbole
C. understatement
D. metaphor

Answers

Answer:

C

Explanation:

The answer is an understatement because understatement is the presentation of something being smaller or less important than how it is and God which is considered as a supreme or mighty being in Christianity is being portrayed through comparison to a dead person in a tomb, and this degrades Him resulting in an understatement.

1 point
3. Shelby and Shannon are both plumbers. Shelby charges $15 per hour
whilst Shannon charges $2 per pipe fixed. Shelby fixes 10 pipes per hour. A
hotel wants to hire a plumber to fix 40 pipes. Which plumber should the
hotel hire?
O A Shelby
O B. Shannon
C. Both
D. None

Answers

Answer:

A. Shelby

Explanation:

This is because in an hour Shelby can fix 10 pipes and will charge only $15. This means that Shelby will be able to fix 40 pipes in 4 hours and will charge $60. On the other hand, Shannon will charge $2 for every pipe fixed; hence 40 pipes will be equivalent to $80. After comparison, it becomes obvious that Shelby should be hired as the hotel will be able to save $20.

NEED DONE ASAP
what are the lyrics to Daft Punk's "Around The World"?

Answers

Answer:

Around the world, around the world

Around the world, around the world

Around the world, around the world

Around the world, around the world

Around the world, around the world

Around the world, around the world

Around the world, around the world

Around the world, around the world

Explanation:

Hope this helps and Have a great day! (^w^)

Answer:

Around the world, around the world

Around the world, around the world

Around the world, around the world

Around the world, around the world

Around the world, around the world

Around the world, around the world

Around the world, around the world

Around the world, around the world

Explanation:

Read the first sentence of the selection.

Day had broken cold and gray, exceedingly cold and gray, when the man turned aside from the main Yukon trail and climbed the high earth bank, where a dim and little-traveled trail led eastward through the fat spruce timberland.

The author’s syntax and use of repetition establishes a tone that is ––


A. cynical

B. malicious

C. foreboding

D. tranquil

Answers

C. A foreboding tone

Foreboding undertones are created by the author's repetition and syntax. Hence, Option C is correct.

What is the meaning of the term “syntax”?

The study of syntax in linguistics deals with the way that words and morphemes come together to form longer units like phrases and sentences.

Word order, grammatical relations, the nature of crosslinguistic variation, agreement, hierarchical sentence structure constituency, and the connection between form and meaning semantics are some of the main topics of syntax.

The fundamental presumptions and objectives of the various approaches to syntax vary. Simple, compound, complex, and compound-complex sentences are different types of sentences, each with a different syntax mode.

A conjunction connects two simple sentences to form a compound sentence. Dependent clauses are found in complex sentences, and both types are seen in compound-complex sentences.

Therefore, Option C is correct.

Learn more about syntax from here:

https://brainly.com/question/28182020

#SPJ2

Maniac Magee Hellp

True or False: Amanda wanted Maniac to give the prize to her parents? *

True
False

Answers

Answer:

False

Explanation:

Could you write a CER summary of the Bird Flu?

Answers

The bird flu is a type of disease caused by strains of influenza. It targets mostly birds, given the name. It has many strains and some are extreme while some are mild. If you become infected, organ failure can transpire. Bird flu in humans makes them cough, have headaches, nausea and it has a 60 percent mortality rate.

what is implied by the use of the adjective untrodden?

Answers

that is a good question keep it up

No Name, No Shame......Poem of mine when I was going through some stuff, it’s not that bad actually but it’s kinda lame


I shouldn’t have fell for you
But what was I supposed to do
You made me feel as if I was worth talking to
But you made the wrong move
Honestly I don’t blame you
At the end of the day, I’m still the girl who cries in the corner of her room

Answers

Answer: here’s mine

no face

no case

do it my way

or the highway

fu ck off

u prolly do golf

the end

amen

Explanation:

November of 2007 marked the one-hundredth anniversary of Oklahoma becoming a state. On November 16, 1907, Oklahoma, which was formed by combining Indian Territory and Oklahoma Territory, became the forty-sixth state to be admitted to the United States. People across the state marked the occasion with a number of centennial celebrations that occurred on November 16, 2007.

Based on its context in the paragraph above, what is the meaning of the word centennial?
A.
election day
B.
traditional pow-wow
C.
annual census
D.
hundredth anniversary

Answers

A soldier or guard shhehehhehehdhdhdhd

One meaning of insolent is "insulting, rude or contemptuous."

Based on this definition, what is the most likely definition of insolence?


full of respect

being disrespectful

apologizing for being rude

having a civil attitude

Answers

Answer:

The answer is B, being disrespectful

Explanation:

I took the quiz

Based on the given definition of insolent as "insulting, rude, or contemptuous," the most likely definition of insolence would be being disrespectful, hence option B is correct.

The term "insolence" describes actions or words that are disrespectful, rude, or demeaning to other people. It entails demonstrating a lack of respect for authority, a disrespect for social norms, or a disregard for expectations.

Condescending, haughty, or disrespectful language or actions towards other people are examples of insolent behaviour. It frequently entails a spirit of defiance, a disdain for the consequences, or a purposeful effort to arouse or annoy.

Insolence can arise in a variety of social circumstances, including private conversations, formal settings, and public discourse.

Learn more about condescending here:

brainly.com/question/13946208

#SPJ6

HELP ME PLZZZZZZZZZZ

Answers

They participated in sacrifices also

Read these lines from "Ozymandias."

And wrinkled lip, and sneer of cold command,
Tell that its sculptor well those passions read
Which yet survive, stamped on these lifeless things,
The hand that mocked them, and the heart that fed;

How does the use of the word mocked in the last line affect the meaning of this text?


It hints that Ozymandias was a skilled military leader.

It suggests that Ozymandias was a cruel ruler.

It shows that Ozymandias was a kind man.

It signals that Ozymandias was a powerful king.

Answers

Answer:

I think it's A but I'm not 100% sure

Explanation:

Answer:

It suggests that Ozymandias was a cruel ruler.

Explanation:

For some reason my answer was removed so including a screenshot.

katie avatar

katie deleted your answer to the question Answer:"It suggests that Ozymandias ...

You've been warned

1 week ago

Reason

Your content has been removed for violating our Community Guidelines

write a letter to the principal of your school to complain about the poor condition of the toilets at your school.

Answers

Answer:

Date:  

Subject:  Regarding the poor condition of the restrooms.

Dear Sir,

I'd like to respectfully raise your attention to the fact that our school's restroom is in terrible shape.  Because of the lack of hygiene, all of the students are unable to use the restrooms.

As a result, I suggest that you take the appropriate measures as quickly as possible, and I will stay grateful to you.

I'm hoping you'll take the appropriate steps,

Sincerely yours,

When a reader studies the combined effect of similes, metaphors, and allusions in Hamlet, the reader is analyzing the
choices.

Answers

Answer:

Language.

Explanation:

When a reader studies the combined effect of similes, metaphors, and allusions in Hamlet, the reader is analyzing the language  choices.

Correct on Edge

When a reader studies the combined effect of similes, metaphors, and allusions in Hamlet, the reader is analyzing the _________choices.

Language

According to the given question, we are asked to show what a reader is analyzing when he is studying the combined effect of literary terms in Hamlet.

As a result of this, we can see that the reader is analyzing the language choices of the use of literary terms in Hamlet such as the effect of the similes, metaphors, and allusions. This is because they all have to do with the diction of the characters.

Therefore, the correct answer is language choices

Read more here:

https://brainly.com/question/12012963

Can someone give me 5 reasons why social media affects your life or mental health

Answers

Answer:

1. It can lower your self esteem, 2. The blue light can cause bad sleep, 3. It can allow people to steal your information, 4. There is no filter in what people say about you, 5. You try to make yourself look happy all the time and that can make you depressed especially when you think that other people are happy all the time.

Explanation:

Bc there are many negative things on social media that can affect ur mental health

from Inaugural Address
by President John F. Kennedy

In your hands, my fellow citizens, more than mine, will rest the final success or failure of our course. Since this country was founded, each generation of Americans has been summoned to give testimony to its national loyalty. The graves of young Americans who answered the call to service surround the globe.
Now the trumpet summons us again—not as a call to bear arms, though arms we need—not as a call to battle, though embattled we are—but a call to bear the burden of a long twilight struggle, year in and year out, "rejoicing in hope, patient in tribulation"—a struggle against the common enemies of man: tyranny, poverty, disease and war itself.
Can we forge against these enemies a grand and global alliance, North and South, East and West, that can assure a more fruitful life for all mankind? Will you join in that historic effort?
In the long history of the world, only a few generations have been granted the role of defending freedom in its hour of maximum danger. I do not shrink from this responsibility—I welcome it. I do not believe that any of us would exchange places with any other people or any other generation. The energy, the faith, the devotion which we bring to this endeavor will light our country and all who serve it—and the glow from that fire can truly light the world.
And so, my fellow Americans: ask not what your country can do for you—ask what you can do for your country.
My fellow citizens of the world: ask not what America will do for you, but what together we can do for the freedom of man.
Finally, whether you are citizens of America or citizens of the world, ask of us here the same high standards of strength and sacrifice which we ask of you. With a good conscience our only sure reward, with history the final judge of our deeds, let us go forth to lead the land we love, asking His blessing and His help, but knowing that here on earth God's work must truly be our own.

Select all the correct answers.
Which two statements best describe the purpose of the passage?
The purpose of the passage is to let people know that weapons are needed, but they need not simply be used in battle.
The purpose of the passage is to inspire Americans to be selfless in their service to the nation and the world.
The purpose of the passage is to invoke all Americans to fight against poverty, disease, and war, for the betterment of mankind.
The purpose of the passage is to inform Americans about the nation's rich, historic past.
The purpose of the passage is to let the world know that the American soldiers have fought bravely in the war.

Answers

Answer:

what

Explanation:

omg ,all that you have ahhhhhh

1 How does Jurgis learn about what happened in the canning department
at Durham?
A. By working in the department for several months
B. By reading accounts in the newspapers
C. By talking to workers in that department
O D. By hearing stories from his wife Marija

Answers

A is the answer To your question
Other Questions
An obstacle to sustainable development is the growth of ecotourism increasing reliance on fossil fuels negative population growth in developed countries farm to table restaurants decrease mass consumption If angle 3 is 4x+1 and angle 4 is 7X+3. what are the measures of angle 3 and 4? Which of the following is NOT a benefit of fitness walking?O Improves your visionO Strengthens your hearto Improves self-image and releases stressO Can be done anywhere, in any weather In a school with 2,000 students, 250 are athletes. Of those athletes, 120 lift weights in addition to participating in their primary sport. Thirty-seven athletes lift weights as their primary sport. The newspaper wants to select five athletes at random from the school to interview. What is the population size?A.) 37B.) 120C.) 250D.) 2,000 When identifying properties of n - sided polygons where 3 _< n Choose the correct simplification of the expression a^9 multiplied by b^10/a^2 multiplied by b^7A^11b^171/a^11b^171/a^7b^3A^7b^3 Suppose you invest money in two accounts. One of the accounts pays 4% interest annually, andthe other account pays 5% interest annually. You have $ 2000 more invested in the account paying4% than in the account paying 5%. How much do you have invested in the account paying 4% ifyou earn $ 670 interest in a year? Fill two Zip Loc bags half full of water. Put food coloring in both bags. Zip both bags. Tape one bag to a sunny window. Tape the other bag to a shady window. After 30 minutes, observe the bags to see which one changed the most. The purpose of the directions above is to OA. describe the results of a safe science experiment OB. entertain the reader with a game of plastic bags. OC. describe the process for a science experiment. OD. persuade the reader to use a certain kind of bag. What belief system was endorsed by the state that ruled the holy land in 550 CE 3. What organ(s) did Jason donate to Ronald Griffin? HELP DUE IN 10 MINS!mWXZ =?? sub (7x+5)(2x28x+6). The boxing world has many famous fights. I will give 3 options of fights that I would like you to research and give me the history of the fight. When it took place, where, who was involved and why it was so significant. In your own words write a paragraph on the fight you choose. Options1) Thrilla in Manila2) Mike Tyson vs. Evander Holyfield3) Rumble in the Jungle How does Jacob Riis allow this transition to happen smoothly 2. Change the fraction to a decimal.a. 6/100b. 43/100c. 3/10d. 4 23/4,000How would I do this? A science researcher has developed a computer model of the process of DNA replication in a eukaryotic cell. The model includes the following sequence of bases in one strand of the DNA molecule. AACCTGGCCATGGACCTTTATATAAACTAGGAT The researcher wants to revise the model to show the transcription of DNA to form mRNA. Identify the choice that best completes the statement or answers the question. Which of these revisions to the model would be most useful for the researcher to include Which of the following could be the number shown on the number line? 6Which of these statements is true?Acceleration in the direction of motion slows you downB.Acceleration in the direction of motion speeds you upCAcceleration against the direction of motion has no effecton your speedDAcceleration against the direction of motion speeds you up Interest groups and political action committees are both types of organizations thatwrite and pass laws at the state and local levels.are not part of the government, but can influence thegovernment.hold debates and town hall meetings to inform voterson major election-season issues.raise unlimited money for political campaigns and candidates. "Master", I said "this sayings had for me."This sentence primarily reflects the role ofA. Dante as PilgrimB. Dante as PoetC. Virgil as guideD. Virgil as teacher