Answer:
QUESTION:
Why do the chromosomes line up in the middle of the cell?
ANSWER:
Chromosomes line up at the metaphase plate, under tension from the mitotic spindle. The two sister chromatids of each chromosome are captured by microtubules from opposite spindle poles. In metaphase, the spindle has captured all the chromosomes and lined them up at the middle of the cell, ready to divide.
Explanation:
Hope that this helps you out! :)
Have a great rest of your day/night!
Answer:
Chromosomes line up at the metaphase plate, under tension from the mitotic spindle. The two sister chromatids of each chromosome are captured by microtubules from opposite spindle poles. In metaphase, the spindle has captured all the chromosomes and lined them up at the middle of the cell, ready to divide.
hope this helps
have a good day :)
Explanation:
As a result of the experiment scientists did with Mexican tetras, it seems likely that their first hypothesis about blindness in the tetras is right. Explain how the result of the experiment supports their first hypothesis.
The scientists' first hypothesis is that blindness gives the fish some sort of evolutionary advantage, but not directly.
The experiment was: The scientists transplanted a lens from the eye of a surface tetra embryo into the eye of a cave tetra embryo. The result was striking—the surface tetra lens into the cave tetra caused all of the surrounding tissues to develop into a healthy eye.
A result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.
What is a hypothesis?An scientific hypothesis is a given explanation to a scientific observation from the real world.
A hypothesis must be verifiable, which means that it can be confirmed or rejected by using the scientific method.
In conclusion, a result that supports the hypothesis 'blindness gives the fish some evolutionary advantage, but not directly' may be a higher fitness in close relatives of fish.
Learn more about hypotheses here:
https://brainly.com/question/11555274
#SPJ1
what is the mRNA in TACCGGATGCCAGATCAAATC?
Answer:
AUGGCCUACGGUCUAGUUUAG
¿Con que otro nombre se le conoce a las placas de espuma de poliuretano altamente contaminante?
Answer:
La espluma de poliuretano (espluma PU) ye un material plásticu porosu formáu por un agregamientu de burbuyes, conocíu tamién polos nomes coloquiales de gomaespuma n'España o gomapluma en dellos países suramericanos. Contienen sustances d'escasu poder canceríxenu que si representen dalgún peligru, namái sería tres esposiciones intenses y teniendo contautu direutu.Tamién ye denomináu Poliuretano proxectáu, por cuenta de la forma na que se suel aplicar sobre superficies. Explanation:
How is energy produced by respiration stored
Answer:
Explanation:
Cellular respiration converts the chemical energy stored in glucose into chemical energy stored in the ATP molecule. The cells break glucose down into carbon dioxide and water while producing energy that they store in ATP molecules.
Answered by the ONE & Only #QUEEN aka #DRIPPQUEENMO
Hope this helped!!!
When a person loses consciousness due to a head injury from a car crash, the ______ keeps the body functioning by regulating the flow of information between the brain and the rest of the body
Answer:
Brain stem
Explanation:
I hope this helps
In protein synthesis, how many nitrogenous bases code for a single amino acid?
one
two
three
four
Answer:
C
Explanation:
EDGE 2022
Which organelle of a cell functions similarly to the envelope of a virus and why?
Answer: linear or circular. include genes encoding viral proteins: capsid, envelope proteins, any polymerase not found in the host cell. viruses may have a lipid envelope.
Which process begins the formation of sedimentary rock?
what does the respritory system do?
Answer:
The respiratory system's main job is to move fresh air into your body while also removing waste gases.
Explanation:
Your lungs are part of the respiratory system, a group of organs and tissues that work together to help you breathe.
help-- multiple choice!
Biogenic sediment is made of at least 30 percent...
acidic chemicals
alkaline properties
limestone or other rock
skeletal remains
Answer:
The answer is the last one, skeletal remains
Answer: Skeletal remains
What is the relationship between the rock cycle and the plate tectonics?
Answer: The metamorphic rocks can erode into sedimentary rocks which can turn into igneous rock. Metamorphic rocks in the rock cycle is driven by tectonic plates.
Explanation:
PLEASE HELP I NEED HELP (Plant related / Project stuff)
Answer:
B, D, A, E, C
Explanation:
1. environmental factors
2. growth
3. adaptation
4. organism
5. genetic factors
How is information for a specific protein carried on the DNA molecule?
a. as a sequence of nucleotides
b. in the double helix shape of the condensed chromosome
c. in the ratio of adenines to thymines
d. as a pattern of phosphates and sugars
Answer:
b
Explanation:
Genetic information is carried in the linear sequence of nucleotides in DNA. Each molecule of DNA is a double helix formed from two complementary strands of nucleotides held together by hydrogen bonds between G-C and A-T base pairs. ... In eucaryotes, DNA is contained in the cell nucleus.
The information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Hence, option (a) is the correct answer.
Nucleic acids are of two types. They are namely deoxyribonucleic acid (DNA) and ribonucleic acid (RNA). DNA molecule carries the information for a specific protein. They are described as follows:
DNA is the genetic material of the cell DNA molecules undergo a process called transcription to code for codons on mRNA strand These codons tend to pair with tRNA molecule which holds the amino acids The amino acids will then form a chain in the sequence of DNA nucleotides to result in protein formationThus, we can conclude that the information for a specific protein is being carried on the DNA molecule as a sequence of nucleotides. Thus, option (a) is the correct answer.
Learn more about DNA here:
https://brainly.com/question/264225
Can someone please help me on this plz I beg u :(
Answer:
Coleoptera is correct! Hope this helps.
explain how at least three pieces of evidence support the theory of evolution.
Dont put any link or else I won’t give brainlist, just answer.
Answer:
1. Fossil evidence
2. Homologous similarities.
3. Molecular evidence
Number the steps from when a stimulus is received to when the body reacts.
_____ The stimulus is received by sensory receptors.
_____ Motor neurons cause muscles to contract so the body can react to the stimulus.
_____ The brain processes the information through interneurons.
_____ Interneurons transfer response information to motor neurons.
_____ Sensory neurons carry stimulus information to the brain or spinal cord.
Answer:
The correct answer is -
1 - The stimulus is received by sensory receptors.
2 - Sensory neurons carry stimulus information to the brain or spinal cord.
3 - The brain processes the information through interneurons.
4 - Interneurons transfer response information to motor neurons.
5 - Motor neurons cause muscles to contract so the body can react to the stimulus.
Explanation:
In most of the organism including humans body response according to the stimulus it receives. The stimulus is received by the sensory receptors to the sensory neurons or afferent neurons that are present on the skin, nose tongue ears, or eyes. Many other receptors and pain receptors present on various internal organs as well.
These sensory neurons carry the stimulus to the spinal cord or brain where this information received by the stimulus process through interneurons and transfer the response of the particular stimulus to the motor neurons. These motor neurons result in muscles contracts so the body can react.
This moray eel has a small fish cleaning between its teeth. The eel gets a
clean mouth while the cleaner fish gets a nice meal.
A.Mutualism
B.Commensalism
C.Parasitism
Answer:
A. Mutualism
Explanation:
The moray eel and the small fish are both getting something out of it. Meaning they both benefit from each other.
Which statement below is NOT a statement within the Cell Theory?
A. all cells come from other cells
B. all organisms are composed of cells
C. the cell is the basic unit or organization of organisms
D. all cells contain DNA (genetic information)
Carbon dioxide enters a plant through pores (openings) called the
A. stomata.
B. cuticle.
C. veins.
3 examples of radioactive dating?
Answer:
Uranium 238
Potassium 40
Rubidium 87
Explanation:
This is a question that has been confusing - In addition to carbon dioxide, what other two ingredients does a plant need for photosynthesis?
Answer:
Carbon dioxide, water and sunlight
Answer:
water and sunlight
Explanation:
Bill Nye Earth's crust
Answer:
1. rock
2. on
3. mantle
4. volcanoes
5. active
6. lava
7. hot
8. coolest
9. geyser
10. resistant
11. tectonic
12. tectonic/pangea
13. caves
14. earthquake
15. crust
Explanation:
why is it important to save energy in our daily lives
Answer:
So you can be more active and do different things that need energy
Explanation:
Having energy is an important part of daily life. Without energy, the human body would not be able to go throughout the day without being tired and without their muscles and bones hurting.
The energy that powers photosynthesis comes from
A. oxygen.
B. water.
C. the sun.
D. chemicals.
Answer:
sun but am not so sure about it
plz no bit.yl stuff, just answers
Sickle cell anemia is a disease that affects the circulatory system.It can be passed from parent to child. Which of the following indicates the significance of this disease?
A.It shows that a disease can cause genetic changes.
B.It is a reflection of how genetic factors affect health.
C.It shows how public health is affected by environmental factors.
D.It indicates how a toxin can play a role in the development of disease.
what process causes stem cells to become immune system cells,then some immune system cells to become antibodies?
Explain the lifecycle of mosquito in short
Answer:
Mosquitoes have 4 life stages: egg, larva, pupa and adult. Mosquitoes can live and reproduce inside and outside the home. The entire life cycle, from an egg to an adult, takes approximately 8-10 days. Hope this helps! :)
I will mark Brainliest for frist answer
Answer:C, to contain the information
Explanation:
Earth science question. Please help
Answer:
answer choice 4, more rain and a steeper slope cause it to flow faster
Explanation:
If a population is evolving, the allele frequency ________