Which statement accurately describes radioactive dating?

A.Geologists use only one type of radioactive dating.
B.Geologists compare parent and daughter elements to determine rock type.
C.Geologists will measure how stable multiple parent elements can decay into multiple daughter elements.
D.Geologist compare the observed abundance of naturally occurring radioactive isotopes and their decay products using decay rates.

Answers

Answer 1

Answer:

D. Geologist compare the observed abundance of naturally occurring radioactive isotopes and their decay products using decay rates.

Explanation:

Radioactive dating is the method in which radioactive isotopes are employed to evaluate the age of rocks and ores. There are many complex radioisotopes utilized for radioactive dating is like Potassium, Uranium, and Carbon. Radioactive dating operates on the system that a radioactive isotope can fade into the constant daughter nuclei at a steady rate. Geologist commonly uses the system for half life. Half-life is the time needed for half of the radioactive element to decline. This is fixed for a selective element.

Answer 2

Answer: D

Explanation:


Related Questions

There is a lot of talk about gaps in the fossil record. This means that we do not necessarily have fossils for every organism that has ever lived. What do you think could account for these gaps in the fossil record?

Answers

Answer:

Explanation:

The rate decomposition of dead remains, to a large extent, determines whether there would be fossils left of the organism after it has been long gone or become extinct. Environmental factors (such as harsh weather condition and early insect invasion of dead remains) could increase the rate of decomposition of dead remains which could really make it difficult for fossils to be available for such organisms under these factors (especially if the organism is restricted to a particular region by nature) .

How is the rock in the deep mantle similar to the rock in the parts of the mantle nearest the surface? How is it different?

Answers

Answer:

Rocks within the mantle contain more magnesium and iron than the ones in the crust. Difference: Rocks in the deep mantle are under intense heat and pressure.

Which of these is an advantage of fossil fuels? *

O Reliable
O Large reserves
O Greenhouse gas emissions
O Non-renewable





Answers

Answer:

reliable

Explanation:

Explanation:

Fossil fuels are a non-renewable resource.

There are many different types of cells with many different types of cellular structures and functions. Which of these structures is found in all types of eukaryotic cells?
A. chloroplast
B. cell wall
C. nucleus
D. centrioles​

Answers

Answer:

nucleus

Explanation:

chloroplasts and cell walls are only found in plant (and fungi) cells, while centrioles are only in animal cells.

The structure that is found in all types of eukaryotic cells is the nucleus. The correct option is C.

What are eukaryotic cells?

Eukaryotic cells are those cells that contain true cell organelle. These cells are present in the higher organism, and they perform complex functions like replication, mitosis, etc.

There are two types of cells. They are prokaryotic and eukaryotic cells. Prokaryotic cells are those that do not contain an organelle and a nucleus. They are present in smaller organisms.

The nucleus is the brain of cells. It controls all functions of cells, and it contains the genetic material of the organisms. In prokaryotic cells, the nucleus is absent and in eukaryotic cells, the nucleus is present. That is the difference between them.

Thus, the correct option is C. nucleus.

To learn more about eukaryotic cells, refer to the link:

https://brainly.com/question/982048

#SPJ6

Which statement best explains the myth about how Romulus and Remus founded Rome?

Answers

After deciding to build a town on one of seven hills, Romulus and Remus had to decide which hill to base it off of and Romulus chose Palatine hill and Remus chose Aventine Hill, Later leaving Romulus to kill Remus in a fight and build the city on Palatine hill hence the name Rome.

Answer: Romulus defeated his brother, then founded Rome on one of the seven hills.

Explanation: Despite there is no answer choices, I'm thinking back on a little quiz I took, and it had the same exact question with the same exact answer choices, and that was the correct answer

Which is the source of energy, which drives the water cycle?

Answers

Answer:

it's the sun

Explanation:

the water cycle is driven primarily by the energy from the sun

Most stars seem to move across the night sky because
a. the universe is expanding
b.the universe is getting smaller
c. Earth is orbiting the Sun
d. Earth is spinning on its axis

Answers

I think it is C but uh if its not D Hope this helps-

Explanation: because

Which objects have the most eccentric orbits?
A. Uranus and Neptune
B. Jupiter and Earth
C Saturn and Venus
D. Mercury and Pluto

Answers

Pluto and mercury is the correct answer

which of the following is problem created when a cell becomes to large

Answers

Answer:

As a cell increases in size, it usually does not make extra copies of DNA. If a cell became too large, an "information crisis" would occur. The cell has more trouble moving enough nutrients and wastes across the cell membrane.

Explanation:

Mitosis is responsible for growth, repair, and maintenance in an organism because

a. it occurs at a faster rate than meiosis.
b. the chromosome number is reduced by half.
c. exact duplicates of each mother cell are produced.
d. it is the only process that involves replication of genetic material.

Answers

Answer:

The correct answer is c

Explanation:

USA test prep

help need answer asap !!

Answers

Wet is irrigation Forest is paper preserving aesthetic value is park trapping sediments as water

write the code for RNA from this DNA STRAND :

AAAAAATTTTTTCCCGGGGTTTATATATC

Answers

Answer:

UUUUUUAAAAAAGGGCCCCAAAUAUAUAG

Explanation:

All you have to do is apply the same concept as DNA, but T (Thymine) is replaced with U (Uracil)

HELP ASAP
Joe is experimenting to determine which liquid will cause bean plants to grow faster. He watered the plants with equal amounts of liquid and measured their height every other day. The plants are in the same pots with different soils and placed in the same location. Will Joe be able to obtain reliable data to write a supported conclusion?
Yes, because he is only observing the height of the plant.
Yes, because he is consistent with watering the plants.
No, because he used different soils.
No, because he uses only one type of plant.

Answers

Answer:

No, because he used different soils.

Explanation:

which liquid will cause bean plants to grow faster.

He watered the plants with equal amounts of liquid and measured their height every other day.

The plants are in the same pots with different soils and placed in the same location.

Ok so last statement made the experiment wrong.

As a constant variable the soil should be the same for all plants only the liquid should change

Helpppppppppppppppppppppppppppppppppp

Answers

Answer:

umm i dont understand your question

Explanation:

The charged particles in the beams that Thomson studied came from atoms. As these particles moved away from their original atoms, they formed a visible beam. The current model of the atom includes protons, neutrons, and electrons.

What is the best use of an atomic model to explain the charge of the particles in Thomson’s beams?

An atom’s negative particles are surrounded by positive matter, so the positive particles are easier to remove.
An atom’s positive particles are surrounded by negative matter, so the negative particles are easier to remove.
An atom’s smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.
An atom’s larger positive particles are at a distance from the central negative particles, so the positive particles are easier to remove.

Answers

The question to the above information is;

What is the best use of an atomic model to explain the charge of the particles in Thomson's beams?

Answer;

An atom's smaller negative particles are at a distance from the central positive particles, so the negative particles are easier to remove.

Explanation;

-Atoms are comprised of a nucleus consisting of protons (red) and neutrons (blue). The number of orbiting electrons is the same as the number of protons and is termed the "atomic number" of the element.

J.J. Thomson discovered the electron. Atoms are neutral overall, therefore in Thomson’s ‘plum pudding model’:

atoms are spheres of positive chargeelectrons are dotted around inside

Answer:

Its C on edge

Explanation:

Which statement is true about gold and helium?
A. They both occur as a gas at room temperature.
B. They are both made of subatomic particles.
C. They are both used in balloons.
D. One of made of protons and the other of only electrons.

Answers

Answer:

The answer is B

B. They are both made of subatomic particles.

Electron transport from complex I to complex IV pumps more protons than transport from complex II to complex IV.
With this in mind, which will produce more ATP

A. Transport from complex I produces more ATP.

B. Transport from complex II produces more ATP.

C. Both produce the same amount of ATP.

Answers

Answer:

A

Explanation:

ATP synthase uses a proton gradient to make ATP. Since transport from complex I creates a larger proton gradient, it also produces more ATP.

Electron transport from complex I produces more ATP.

ELECTRON TRANSPORT CHAIN:

The electron transport chain, ETC, is the third and last stage of aerobic cellular respiration. It produces the highest molecules of ATP in cellular respiration.

The ETC involves the transfer of electrons to series of molecules in order to create an electrochemical gradient needed for ATP synthesis.

The electron transport chain is made up of four complexes namely: Complex I, II, III and IV. NADH and FADH2 produced in the Krebs cycle are the electron carriers.

Complex I pumps more hydrogen ions (H+) from the mitochondrial matrix to the intermembrane space.

Since the pumped is directly related to the number of ATP molecules, complex I will produce more ATP molecules.

Learn more: https://brainly.com/question/442662?referrer=searchResults

What is the purpose of the other tube of water?

Answers

Explanation:

cant see photo

Answer:

delude the other thing

there is no picture so i have no idea what your asking. ill edit this answer to be more specific when you explain

Explanation:

Why are some theories more widely accepted than others such as the theory of evolution?

Answers

Answer:

Scientific theories is accepted as a scientific truth, supported by evidence collected by many scientists. The theory of evolution by natural selection is a classic theory. Keeping in mind a Hypothesis is a possible answer to scientific questions.

Explanation:

I majored in Biology

PLEASE HELP
Fact vs. Opinion
Read each statement and decide if it is a fact (can be proven with evidence) or an opinion (personal belief).
8. Different cell types also have special duties, like building skin or bone, pumping out hormones, or making antibodies.
9. Animal cells are more interesting than plant cells.
10. Proteins are processed and lipids are manufactured in the smooth endoplasmic reticulum and Golgi apparatus.

Answers

Answer:

8 fact 9: opinion 10: fact

Explanation:

Answer:

8. Fact

9. Opinion

10. Fact

How does evolution result in reproductive success?

Answers

Answer:

Often when species evolve, they receive a trait that may make them live longer or make it where their survival chances are significantly increased. Which in turn can make their offspring stronger and able to live longer, therefore increasing their population.

20 points and will mark brainliest! Please explain how you got it though

Answers

Answer:

crossing over during meiosis

Explanation:

i just had biology last semester hope this helps

If the food on the island is small seeds, what finch is best adapted? Explain why

Answers

Answer:Adaptation in Darwins Finches. Beak depth, which is correlated with body size and the ability to crack larger seeds, varies according to drought conditions: plants produce fewer, harder seeds in dry years and more, softer seeds in wet years. Only larger birds with deeper depths survive in drought years.

Explanation:

A dead organism takes matter out of the ecosystem cycle and that matter
can never be used again. *
O True
False

Answers

Answer:

Decomposers break down dead organisms into nutrients and gases so that they can be used by other organisms. Nutrients can enter or exit an ecosystem at any point and can cycle around the planet.

Answer:

False

Explanation:

Drag each tile to the correct box. COOL PICS
Arrange the organisms from fastest to slowest based on the time they’d take to complete the 20th Carnegie stage.





mouse
baboon
chicken
human
sheep

Answers

Answer:

Fastest- chicken

mouse

sheep

baboon

Slowest-human

Explanation:

Answer:

Fastest- chicken

mouse

sheep

baboon

Slowest-human

Explanation:

HURRY. Why is transcription said to be unidirectional?

Answers

Answer:

Transcription is unidirectional because you are copying only ONE side of the DNA. Remember that DNA is a double stranded helical structure. One strand of DNA is complementary to the other strand.

Explanation:

“Fish and other wildlife become unhealthy and die without __________.”

Oxygen
Carbon Dioxide
Eutrophication

(This is 7th grade science)

Answers

Answer:

Oxygen

Explanation:

Andwer is oxygen if not then eutrophication

Can you tell me which go where?

Answers

Answer:

heredity goes to the first one

phenotype at the second one

Explanation:

Which factor makes enzymes well-suited to the role of catalyst in a biochemical reaction?

A)Enzymes do not affect the energy of a reaction.

B)Enzymes slow down reactions so products can form.

C)Enzymes can be reused because they do not permanently bond with substrate.

D)Enzymes can only bind to other enzymes so the same product is formed each time.

Answers

Answer: C

Explanation: Once an enzyme binds to a substrate and catalyzes the reaction, the enzyme is released, unchanged, and can be used for another reaction.

Enzymes can be reused because they do not permanently bond with substrate.

What are Enzymes?

A biological catalyst called an enzyme is usually always a protein. It accelerates a certain chemical reaction in the cell. The enzyme is continuously employed during the reaction and is not destroyed. Each enzyme molecule found in a cell is unique and tailored to a particular chemical reaction.

Proteins called enzymes assist our bodies' chemical reactions move forward more quickly. For several processes, including digestion and liver function, enzymes are crucial.

Health issues might result from having too much or too little of a specific enzyme. Healthcare professionals can also use the enzymes in our blood to look for injuries and illnesses.

Therefore, Enzymes can be reused because they do not permanently bond with substrate.

To learn more about Enzyme, refer to the link:

https://brainly.com/question/14953274

#SPJ6

What is the atomic mass of Sulfur that has 18 neutrons?

Answers

Answer:  32.066 atomic mass units

B is the correct option.

Other Questions
I need help with my wirk What does an object do when it accelerates A bicyclist has a mass of 112 kg. In which of the following situations will the cyclist have the most kinetic energy? A) 10 km / hr.B) 12 km/hr C) 14 km / hr D) 16 km/hr True or false? An intrusionis always younger thana fault.TrueFalse Under Presidential Reconstruction, Confederate leaders and wealthy Southerners had to __________ in order to regain the right to vote. a. reapply for citizenship b. receive a presidential pardon c. be approved by Andrew Hamilton d. pay additional taxes 5(x + 3) represents the area of the rectangle above. Which expression below isequivalent by the Distributive Property? (4 points)1) 5x + 3O2) (5 + x) + 33) 5x + 15O4) (x + 3) - 5ILL GIVE BRAINLIEST 3y-z ; use y=6 and z=6 What is the difference between dans un and au?Why would it be je suis all dans un parc dattraction but nous sommes alls au restaurant? Which of the following terms best describes the product development life cycle process?descriptiveiterativeStaticevaluative The fraction 9/7 is not a proper fraction.true or false Why were African enslaved and brought to the Americans Mira el mapa y escoge la opcin correcta con el pas indicado en el mapa. Look at the map and choose the correct option with the country indicated on the map. Map of Central and South America. The country highlighted is immediately south of Panama, with half of its northern coast in the Atlantic and half of its northern coast in the Pacific. A. Colombia B. Argentina C. Uruguay D. Paraguay Can anyone please translate this into proper Spanish! I need this and the translator is of no use.This part~~~The weather had been so warm in recent days, the air so velvety on the skin. It was a spa from the time the light filtered over the hills until it too took its rest. Clouds drifted by on the most relaxed of breezes, helping our eyes to appreciate the bluebird sky all the more. The rain, when it came, alighted as softly as the shoes of a ballet dancer, adorning and rejuvenating the only stage that mattered.Are you free this evening?I asked Lily, my girl friend. I fell at first sight for her. Her hair was blonde, fairy tale kind of blonde, and her eyes deep hues of blue. Are you free? I asked again.Yes. She yawned, clearly disinterested with the conversation."No, I"Jack?Hey...hey! Looktherethe window I pointed out through the crystal clear glass.What is it?Its Je... Jeon I managed out.But Becca said he died. This is correct right? Isaac walks 6/10 of a mile of a mile in 1/5 of an hour. If Isaacs walking rate remains constant, what is Isaacs walking rate in miles per hour? In your own words explain how acceleration differs from uniform motion. Not sure can someone help Find the exact length of the third side I will mark you brainliest if you go subscribe to seema beauty care and more on y o u t u b e and put the screenshot in answer. Select the correct bisector of the segment.BABBBMBBD